Incidental Mutation 'R2993:Cyp4a31'
ID257959
Institutional Source Beutler Lab
Gene Symbol Cyp4a31
Ensembl Gene ENSMUSG00000028712
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 31
Synonyms
MMRRC Submission 040528-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2993 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115563649-115579015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115569820 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 206 (V206I)
Ref Sequence ENSEMBL: ENSMUSP00000117129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030480] [ENSMUST00000030486] [ENSMUST00000126645] [ENSMUST00000141033]
Predicted Effect probably benign
Transcript: ENSMUST00000030480
AA Change: V192I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000030480
Gene: ENSMUSG00000028712
AA Change: V192I

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 415 3.6e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000030486
AA Change: V207I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000030486
Gene: ENSMUSG00000028712
AA Change: V207I

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 504 2.6e-134 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126645
AA Change: V206I

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000117129
Gene: ENSMUSG00000028712
AA Change: V206I

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 340 4.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141033
SMART Domains Protein: ENSMUSP00000115628
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 155 2.9e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik A G 3: 124,578,535 W67R probably damaging Het
2210011C24Rik A G 8: 84,011,584 L34P probably damaging Het
2610528A11Rik T A 14: 37,107,445 H27L probably benign Het
4931408C20Rik A T 1: 26,685,828 D90E possibly damaging Het
Abca16 T C 7: 120,535,161 V1377A probably damaging Het
Adarb2 A C 13: 8,713,716 I550L probably benign Het
Afdn T C 17: 13,891,000 probably null Het
Ago1 G T 4: 126,440,046 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdc7 G A 5: 106,973,898 V226I probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Ddx47 G T 6: 135,018,981 R120L probably damaging Het
Dnah7a G A 1: 53,503,554 L2486F probably damaging Het
Eif3d A G 15: 77,961,705 I372T possibly damaging Het
Eogt A T 6: 97,118,954 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Fbxl2 T C 9: 113,989,416 E159G possibly damaging Het
Gabrb2 T C 11: 42,597,649 V314A probably damaging Het
Gtf2h3 T C 5: 124,583,934 F32L probably benign Het
Gzmk A G 13: 113,180,477 I56T probably damaging Het
Katnbl1 G T 2: 112,408,618 probably null Het
Klhdc4 G C 8: 121,806,581 S118* probably null Het
Klrb1-ps1 A T 6: 129,121,029 K73N probably benign Het
Lrp1 T C 10: 127,610,381 D98G probably damaging Het
Lrrfip1 C A 1: 91,105,234 D313E probably damaging Het
Mmp21 C T 7: 133,678,986 R85H probably damaging Het
Mrpl16 A G 19: 11,774,531 I218M possibly damaging Het
Mtmr4 T A 11: 87,604,997 V553D probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Vmn1r224 T A 17: 20,419,210 S16R probably damaging Het
Vmn2r55 C T 7: 12,684,955 A13T probably damaging Het
Zer1 A G 2: 30,101,897 V637A probably damaging Het
Other mutations in Cyp4a31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cyp4a31 APN 4 115574974 unclassified probably benign
IGL01682:Cyp4a31 APN 4 115578031 missense probably damaging 0.97
IGL02112:Cyp4a31 APN 4 115570983 missense probably damaging 1.00
IGL02292:Cyp4a31 APN 4 115566501 missense probably damaging 0.98
IGL02343:Cyp4a31 APN 4 115563829 missense probably damaging 1.00
IGL02508:Cyp4a31 APN 4 115571064 missense probably damaging 1.00
IGL03094:Cyp4a31 APN 4 115578108 utr 3 prime probably benign
IGL03493:Cyp4a31 APN 4 115570755 splice site probably null
R0400:Cyp4a31 UTSW 4 115563718 start codon destroyed probably null 1.00
R1263:Cyp4a31 UTSW 4 115574711 missense probably benign 0.01
R1508:Cyp4a31 UTSW 4 115565053 missense possibly damaging 0.53
R1523:Cyp4a31 UTSW 4 115569754 missense probably benign 0.23
R1822:Cyp4a31 UTSW 4 115566613 splice site probably null
R1832:Cyp4a31 UTSW 4 115569731 missense probably benign
R1872:Cyp4a31 UTSW 4 115574736 missense probably damaging 0.99
R2351:Cyp4a31 UTSW 4 115571313 missense possibly damaging 0.95
R2426:Cyp4a31 UTSW 4 115571016 missense probably damaging 0.98
R3743:Cyp4a31 UTSW 4 115566519 missense possibly damaging 0.95
R3812:Cyp4a31 UTSW 4 115566509 missense probably benign
R3963:Cyp4a31 UTSW 4 115574772 unclassified probably benign
R4211:Cyp4a31 UTSW 4 115565013 missense probably benign 0.01
R4814:Cyp4a31 UTSW 4 115570269 missense probably damaging 1.00
R6245:Cyp4a31 UTSW 4 115571348 missense possibly damaging 0.91
R6255:Cyp4a31 UTSW 4 115574920 missense possibly damaging 0.82
R6330:Cyp4a31 UTSW 4 115563877 missense probably damaging 0.99
R6433:Cyp4a31 UTSW 4 115570269 missense probably damaging 1.00
R6602:Cyp4a31 UTSW 4 115569707 critical splice acceptor site probably null
R6844:Cyp4a31 UTSW 4 115563792 missense probably null 0.00
R7154:Cyp4a31 UTSW 4 115574766 critical splice donor site probably null
R7300:Cyp4a31 UTSW 4 115570271 missense probably benign 0.03
R8188:Cyp4a31 UTSW 4 115569746 missense probably benign 0.29
X0020:Cyp4a31 UTSW 4 115565109 missense probably benign 0.06
X0021:Cyp4a31 UTSW 4 115577961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCAACTGAACACATGTCTTC -3'
(R):5'- CCGCAGATAGAATGGACTCTG -3'

Sequencing Primer
(F):5'- GTCAACTGAACACATGTCTTCTGAGG -3'
(R):5'- GCATGAGTGACTAGGCATCTACC -3'
Posted On2015-01-11