Mutagenetix > Incidental Mutation

Incidental Mutation 'R2993:Ago1'

257960

Institutional Source

Beutler Lab

Gene Symbol

Ago1

Ensembl Gene

ENSMUSG00000041530

Gene Name

argonaute RISC catalytic subunit 1

Synonyms

Eif2c1, argonaute 1

MMRRC Submission

040528-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.811) question?

Stock #

R2993 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126435012-126468583 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 126440046 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097888] [ENSMUST00000176315]

AlphaFold

Q8CJG1

Predicted Effect

probably benign
Transcript: ENSMUST00000097888

SMART Domains

Protein: ENSMUSP00000095498
Gene: ENSMUSG00000041530

Domain	Start	End	E-Value	Type
Pfam:ArgoN	26	164	2.3e-26	PFAM
DUF1785	173	225	3.48e-25	SMART
PAZ	233	368	1.41e-5	SMART
Pfam:ArgoL2	373	418	3.6e-18	PFAM
Pfam:ArgoMid	427	509	7.6e-37	PFAM
Piwi	515	816	4.16e-131	SMART
Blast:Piwi	823	849	3e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000127800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156533

Predicted Effect

probably benign
Transcript: ENSMUST00000176315

SMART Domains

Protein: ENSMUSP00000134871
Gene: ENSMUSG00000041530

Domain	Start	End	E-Value	Type
Pfam:PAZ	1	62	4.1e-23	PFAM
Piwi	211	512	4.16e-131	SMART
Blast:Piwi	519	545	2e-6	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: This gene encodes a member of the argonaute family of proteins, which associate with small RNAs and have important roles in RNA interference (RNAi) and RNA silencing. This protein binds to microRNAs (miRNAs) or small interfering RNAs (siRNAs) and represses translation of mRNAs that are complementary to them. It is also involved in transcriptional gene silencing (TGS) of promoter regions that are complementary to bound short antigene RNAs (agRNAs), as well as in the degradation of miRNA-bound mRNA targets. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A recent study showed this gene to be an authentic stop codon readthrough target, and that its mRNA could give rise to an additional C-terminally extended isoform by use of an alternative in-frame translation termination codon. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a conditional allele activated in keratinocytes exhibit no abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	A	G	3: 124,578,535	W67R	probably damaging	Het
2210011C24Rik	A	G	8: 84,011,584	L34P	probably damaging	Het
2610528A11Rik	T	A	14: 37,107,445	H27L	probably benign	Het
4931408C20Rik	A	T	1: 26,685,828	D90E	possibly damaging	Het
Abca16	T	C	7: 120,535,161	V1377A	probably damaging	Het
Adarb2	A	C	13: 8,713,716	I550L	probably benign	Het
Afdn	T	C	17: 13,891,000		probably null	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Cdc7	G	A	5: 106,973,898	V226I	probably benign	Het
Cdh15	G	A	8: 122,862,024	R279Q	probably damaging	Het
Cyp4a31	G	A	4: 115,569,820	V206I	probably benign	Het
Ddx47	G	T	6: 135,018,981	R120L	probably damaging	Het
Dnah7a	G	A	1: 53,503,554	L2486F	probably damaging	Het
Eif3d	A	G	15: 77,961,705	I372T	possibly damaging	Het
Eogt	A	T	6: 97,118,954		probably null	Het
Epb42	G	A	2: 121,029,044		probably benign	Het
Fbxl2	T	C	9: 113,989,416	E159G	possibly damaging	Het
Gabrb2	T	C	11: 42,597,649	V314A	probably damaging	Het
Gtf2h3	T	C	5: 124,583,934	F32L	probably benign	Het
Gzmk	A	G	13: 113,180,477	I56T	probably damaging	Het
Katnbl1	G	T	2: 112,408,618		probably null	Het
Klhdc4	G	C	8: 121,806,581	S118*	probably null	Het
Klrb1-ps1	A	T	6: 129,121,029	K73N	probably benign	Het
Lrp1	T	C	10: 127,610,381	D98G	probably damaging	Het
Lrrfip1	C	A	1: 91,105,234	D313E	probably damaging	Het
Mmp21	C	T	7: 133,678,986	R85H	probably damaging	Het
Mrpl16	A	G	19: 11,774,531	I218M	possibly damaging	Het
Mtmr4	T	A	11: 87,604,997	V553D	probably damaging	Het
Rap1gap2	C	A	11: 74,407,322	A491S	possibly damaging	Het
Secisbp2l	C	T	2: 125,740,737	G933D	possibly damaging	Het
Vmn1r224	T	A	17: 20,419,210	S16R	probably damaging	Het
Vmn2r55	C	T	7: 12,684,955	A13T	probably damaging	Het
Zer1	A	G	2: 30,101,897	V637A	probably damaging	Het

Other mutations in Ago1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01377:Ago1	APN	4	126459817	missense	probably damaging	0.98
IGL02578:Ago1	APN	4	126439531	missense	probably benign	0.12
IGL02709:Ago1	APN	4	126453640	nonsense	probably null
IGL02810:Ago1	APN	4	126443093	missense	probably benign	0.00
IGL03037:Ago1	APN	4	126461794	missense	probably benign	0.00
IGL03091:Ago1	APN	4	126459189	missense	probably damaging	0.98
IGL03100:Ago1	APN	4	126443171	missense	probably benign	0.08
IGL03121:Ago1	APN	4	126460003	missense	probably benign	0.00
R0195:Ago1	UTSW	4	126463691	missense	probably benign	0.01
R0244:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R0309:Ago1	UTSW	4	126443166	missense	probably benign	0.06
R0514:Ago1	UTSW	4	126439595	missense	probably benign
R0557:Ago1	UTSW	4	126460024	missense	probably benign	0.00
R1104:Ago1	UTSW	4	126453633	missense	probably damaging	0.99
R1553:Ago1	UTSW	4	126440401	missense	probably damaging	0.99
R1624:Ago1	UTSW	4	126463741	missense	probably damaging	0.97
R1851:Ago1	UTSW	4	126439995	missense	probably benign	0.00
R1867:Ago1	UTSW	4	126441236	missense	probably damaging	0.98
R2001:Ago1	UTSW	4	126454394	missense	probably null	0.36
R2051:Ago1	UTSW	4	126460453	missense	probably benign	0.01
R2057:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R2105:Ago1	UTSW	4	126461788	missense	probably benign	0.30
R2117:Ago1	UTSW	4	126463857	splice site	probably null
R2256:Ago1	UTSW	4	126441911	missense	possibly damaging	0.80
R2272:Ago1	UTSW	4	126453650	missense	probably benign	0.01
R2517:Ago1	UTSW	4	126439939	nonsense	probably null
R2850:Ago1	UTSW	4	126443075	splice site	probably benign
R3746:Ago1	UTSW	4	126461044	missense	probably benign
R3747:Ago1	UTSW	4	126461044	missense	probably benign
R3750:Ago1	UTSW	4	126461044	missense	probably benign
R4600:Ago1	UTSW	4	126460392	missense	probably benign	0.37
R4934:Ago1	UTSW	4	126448859	missense	possibly damaging	0.56
R4983:Ago1	UTSW	4	126453654	missense	probably damaging	0.99
R5086:Ago1	UTSW	4	126453604	missense	probably benign	0.01
R5132:Ago1	UTSW	4	126461723	missense	probably benign	0.01
R5239:Ago1	UTSW	4	126441215	missense	probably damaging	1.00
R5609:Ago1	UTSW	4	126461037	missense	possibly damaging	0.80
R5705:Ago1	UTSW	4	126448794	missense	probably benign	0.01
R5980:Ago1	UTSW	4	126460569	unclassified	probably benign
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6036:Ago1	UTSW	4	126443228	missense	probably damaging	0.98
R6398:Ago1	UTSW	4	126448808	missense	probably benign	0.26
R6505:Ago1	UTSW	4	126463835	missense	probably benign	0.00
R6545:Ago1	UTSW	4	126454352	missense	possibly damaging	0.74
R6944:Ago1	UTSW	4	126460422	missense	possibly damaging	0.78
R7041:Ago1	UTSW	4	126463706	missense	possibly damaging	0.94
R7490:Ago1	UTSW	4	126439505	makesense	probably null
R7496:Ago1	UTSW	4	126461752	missense	probably benign	0.20
R7575:Ago1	UTSW	4	126453908	missense	probably benign	0.12
R7625:Ago1	UTSW	4	126443229	missense	probably benign	0.18
R7988:Ago1	UTSW	4	126460417	missense	probably damaging	1.00
R8041:Ago1	UTSW	4	126441936	missense	probably damaging	1.00
R8073:Ago1	UTSW	4	126443226	missense	probably benign	0.04
R8086:Ago1	UTSW	4	126460981	missense	probably benign
R8127:Ago1	UTSW	4	126454421	missense	possibly damaging	0.95
R8772:Ago1	UTSW	4	126460523	unclassified	probably benign
R8878:Ago1	UTSW	4	126463723	missense	probably benign	0.35
R8989:Ago1	UTSW	4	126463790	missense	probably benign	0.01
R9140:Ago1	UTSW	4	126443184	missense	probably benign
X0025:Ago1	UTSW	4	126443115	missense	possibly damaging	0.47
Z1177:Ago1	UTSW	4	126453656	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTCCTTGTCCACCAGGTG -3'
(R):5'- CATTAGCTAGCCCCAAGTGTAC -3'

Sequencing Primer
(F):5'- TGGTATCGTGCCCGGAAAG -3'
(R):5'- GGGTATGGTCATGCAAC -3'

Posted On

2015-01-11