Incidental Mutation 'R2993:Klrb1-ps1'
ID257964
Institutional Source Beutler Lab
Gene Symbol Klrb1-ps1
Ensembl Gene ENSMUSG00000079295
Gene Namekiller cell lectin-like receptor subfamily B member 1, pseudogene 1
SynonymsNkrp1e
MMRRC Submission 040528-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R2993 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location129116518-129129446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129121029 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 73 (K73N)
Gene Model predicted gene model for transcript(s):
Predicted Effect probably benign
Transcript: ENSMUST00000071391
AA Change: K73N

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071342
Gene: ENSMUSG00000079295
AA Change: K73N

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
CLECT 94 170 1.28e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203057
Meta Mutation Damage Score 0.1633 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (34/34)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik A G 3: 124,578,535 W67R probably damaging Het
2210011C24Rik A G 8: 84,011,584 L34P probably damaging Het
2610528A11Rik T A 14: 37,107,445 H27L probably benign Het
4931408C20Rik A T 1: 26,685,828 D90E possibly damaging Het
Abca16 T C 7: 120,535,161 V1377A probably damaging Het
Adarb2 A C 13: 8,713,716 I550L probably benign Het
Afdn T C 17: 13,891,000 probably null Het
Ago1 G T 4: 126,440,046 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Cdc7 G A 5: 106,973,898 V226I probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cyp4a31 G A 4: 115,569,820 V206I probably benign Het
Ddx47 G T 6: 135,018,981 R120L probably damaging Het
Dnah7a G A 1: 53,503,554 L2486F probably damaging Het
Eif3d A G 15: 77,961,705 I372T possibly damaging Het
Eogt A T 6: 97,118,954 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Fbxl2 T C 9: 113,989,416 E159G possibly damaging Het
Gabrb2 T C 11: 42,597,649 V314A probably damaging Het
Gtf2h3 T C 5: 124,583,934 F32L probably benign Het
Gzmk A G 13: 113,180,477 I56T probably damaging Het
Katnbl1 G T 2: 112,408,618 probably null Het
Klhdc4 G C 8: 121,806,581 S118* probably null Het
Lrp1 T C 10: 127,610,381 D98G probably damaging Het
Lrrfip1 C A 1: 91,105,234 D313E probably damaging Het
Mmp21 C T 7: 133,678,986 R85H probably damaging Het
Mrpl16 A G 19: 11,774,531 I218M possibly damaging Het
Mtmr4 T A 11: 87,604,997 V553D probably damaging Het
Rap1gap2 C A 11: 74,407,322 A491S possibly damaging Het
Secisbp2l C T 2: 125,740,737 G933D possibly damaging Het
Vmn1r224 T A 17: 20,419,210 S16R probably damaging Het
Vmn2r55 C T 7: 12,684,955 A13T probably damaging Het
Zer1 A G 2: 30,101,897 V637A probably damaging Het
Other mutations in Klrb1-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Klrb1-ps1 APN 6 129116585 missense possibly damaging 0.91
IGL02067:Klrb1-ps1 APN 6 129129388 missense probably damaging 1.00
IGL02218:Klrb1-ps1 APN 6 129129306 splice site noncoding transcript
IGL02316:Klrb1-ps1 APN 6 129116569 exon noncoding transcript
R0035:Klrb1-ps1 UTSW 6 129129343 missense possibly damaging 0.80
R2972:Klrb1-ps1 UTSW 6 129119756 splice site noncoding transcript
R5076:Klrb1-ps1 UTSW 6 129119788 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CCTCAGCCCAGTTTGCTAAG -3'
(R):5'- CACTGGAAAGAGAGGCCCTTTG -3'

Sequencing Primer
(F):5'- CAGCCCAGTTTGCTAAGATTTTATTC -3'
(R):5'- GGCCCTTTGGACTTGCAAAC -3'
Posted On2015-01-11