Incidental Mutation 'R1817:Zfp970'
ID257995
Institutional Source Beutler Lab
Gene Symbol Zfp970
Ensembl Gene ENSMUSG00000078866
Gene Namezinc finger protein 970
SynonymsGm14420
MMRRC Submission 039845-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R1817 (G1)
Quality Score77
Status Validated
Chromosome2
Chromosomal Location177464733-177478129 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 177476183 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 517 (H517Y)
Ref Sequence ENSEMBL: ENSMUSP00000104580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099002] [ENSMUST00000108952]
Predicted Effect probably benign
Transcript: ENSMUST00000099002
SMART Domains Protein: ENSMUSP00000096600
Gene: ENSMUSG00000078866

DomainStartEndE-ValueType
KRAB 4 66 3.68e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108952
AA Change: H517Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104580
Gene: ENSMUSG00000078866
AA Change: H517Y

DomainStartEndE-ValueType
KRAB 4 66 1.13e-13 SMART
ZnF_C2H2 78 97 1.53e2 SMART
ZnF_C2H2 103 125 8.75e0 SMART
ZnF_C2H2 131 153 1.28e-3 SMART
ZnF_C2H2 159 181 3.89e-3 SMART
ZnF_C2H2 187 209 3.63e-3 SMART
ZnF_C2H2 215 237 3.89e-3 SMART
ZnF_C2H2 243 265 1.58e-3 SMART
ZnF_C2H2 271 293 7.9e-4 SMART
ZnF_C2H2 299 321 3.69e-4 SMART
ZnF_C2H2 327 349 2.12e-4 SMART
ZnF_C2H2 355 377 1.56e-2 SMART
ZnF_C2H2 383 405 1.12e-3 SMART
ZnF_C2H2 411 433 1.79e-2 SMART
ZnF_C2H2 439 461 3.69e-4 SMART
ZnF_C2H2 467 489 3.21e-4 SMART
ZnF_C2H2 495 517 7.9e-4 SMART
Meta Mutation Damage Score 0.1210 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 91.9%
Validation Efficiency 95% (90/95)
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,219,318 S600T probably benign Het
Acly T A 11: 100,495,891 Q615L probably benign Het
Adgrf1 C A 17: 43,310,033 T387K probably benign Het
Afg3l1 G T 8: 123,501,931 K745N probably damaging Het
Armc8 T C 9: 99,536,259 T39A possibly damaging Het
Atm C A 9: 53,492,233 probably benign Het
Babam2 A G 5: 32,057,546 T324A probably damaging Het
Btd C A 14: 31,662,289 D77E possibly damaging Het
Cadm1 T A 9: 47,829,370 probably benign Het
Card11 A T 5: 140,885,560 D729E probably benign Het
Ccni G T 5: 93,188,108 T144K possibly damaging Het
Cecr2 A G 6: 120,731,267 T77A probably damaging Het
Cpsf7 T C 19: 10,535,439 F296L possibly damaging Het
Cyfip1 C A 7: 55,873,448 N70K possibly damaging Het
Cyp4a12b A G 4: 115,414,062 probably benign Het
Ddx20 A T 3: 105,678,580 Y816* probably null Het
Ddx59 A G 1: 136,432,507 I420V probably damaging Het
Dgat1 T A 15: 76,502,503 M445L probably damaging Het
Dnah5 T A 15: 28,246,400 L628* probably null Het
Dnah7a A C 1: 53,559,148 D1409E probably benign Het
Dnmt1 T C 9: 20,927,126 T215A probably benign Het
Dsg4 C T 18: 20,471,245 T923M probably damaging Het
Enox1 A G 14: 77,615,475 I394V possibly damaging Het
Esrp2 A T 8: 106,134,618 M183K probably damaging Het
Fam171a1 C T 2: 3,178,373 P79S probably benign Het
Fga A G 3: 83,031,775 T486A probably benign Het
Fkbp10 G T 11: 100,415,889 A36S probably benign Het
Fnip1 A G 11: 54,502,453 T572A probably benign Het
Fxn A C 19: 24,280,401 probably null Het
Gaa C T 11: 119,284,498 Q901* probably null Het
Gabrg1 A G 5: 70,754,251 M344T probably benign Het
Galnt7 C T 8: 57,538,178 V433M probably damaging Het
Gin1 A G 1: 97,785,226 probably null Het
Gm5155 C T 7: 17,873,330 noncoding transcript Het
Hydin A C 8: 110,532,827 D2477A probably benign Het
Igsf6 T C 7: 121,070,808 Y37C probably damaging Het
Il18rap A G 1: 40,531,527 I210V probably benign Het
Kif3a T C 11: 53,598,734 Y138H probably damaging Het
Klra17 A G 6: 129,868,718 probably null Het
Lcorl A T 5: 45,795,346 I55N probably damaging Het
Lrrc49 A G 9: 60,602,776 S398P possibly damaging Het
Ltv1 A G 10: 13,179,274 L384S probably damaging Het
Mageb3 A T 2: 121,954,437 Y261* probably null Het
Mb21d1 A G 9: 78,434,311 probably null Het
Mical3 T G 6: 121,042,235 T9P probably benign Het
Mpp6 T G 6: 50,163,431 F144V probably benign Het
Myrip C T 9: 120,388,162 S49L probably damaging Het
Nrap T C 19: 56,384,055 probably benign Het
Olfr164 T C 16: 19,285,877 N289D probably damaging Het
Olfr729 A G 14: 50,148,271 V201A probably benign Het
Otoa A T 7: 121,160,530 probably benign Het
Parp11 T A 6: 127,490,045 I133N probably damaging Het
Pcnx A G 12: 81,918,642 T528A probably benign Het
Pde4c A G 8: 70,726,989 H63R probably benign Het
Pdpk1 T C 17: 24,110,904 K53E probably damaging Het
Pdzd7 A T 19: 45,036,176 M468K probably damaging Het
Perm1 C A 4: 156,218,604 P535Q possibly damaging Het
Pgap1 C A 1: 54,535,969 A265S probably benign Het
Pik3c2a A T 7: 116,376,512 probably null Het
Plxnd1 T C 6: 115,980,601 T491A possibly damaging Het
Pms1 A T 1: 53,206,969 D470E probably benign Het
Prf1 C A 10: 61,302,983 T240N probably damaging Het
Prune2 A G 19: 17,122,081 T1650A probably benign Het
Ptprf A G 4: 118,223,265 L1264P probably benign Het
Ptprs A G 17: 56,419,527 S948P probably damaging Het
Rapgef1 T C 2: 29,686,256 V117A probably damaging Het
Rnf123 A G 9: 108,062,926 V756A probably benign Het
Sez6l2 A G 7: 126,967,119 E741G probably damaging Het
Shc3 A T 13: 51,472,852 I125K possibly damaging Het
Smr3a A T 5: 88,008,058 probably benign Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
St6gal1 A T 16: 23,321,333 K85* probably null Het
Taf1b T G 12: 24,547,122 D353E possibly damaging Het
Tcp10b C T 17: 13,067,703 P180S possibly damaging Het
Tlr9 A T 9: 106,224,943 M478L probably benign Het
Tpr A T 1: 150,419,903 E892D probably damaging Het
Trio C T 15: 27,742,495 W22* probably null Het
Usp14 A G 18: 10,024,673 V8A probably damaging Het
Vmn2r19 A T 6: 123,330,052 K506N possibly damaging Het
Vmn2r45 T A 7: 8,472,373 N552I probably damaging Het
Vmn2r56 A T 7: 12,715,615 M232K probably benign Het
Vps13b T A 15: 35,910,642 F3517L possibly damaging Het
Yif1a C T 19: 5,092,305 R247* probably null Het
Zbtb5 A G 4: 44,993,767 V539A probably benign Het
Zfp180 G A 7: 24,105,227 R357Q probably damaging Het
Zfp536 A G 7: 37,568,617 L458P probably damaging Het
Zfp646 G A 7: 127,883,120 G1490S probably benign Het
Zranb3 A T 1: 128,017,556 probably null Het
Other mutations in Zfp970
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Zfp970 APN 2 177474817 splice site probably benign
R1992:Zfp970 UTSW 2 177474870 missense possibly damaging 0.55
R2252:Zfp970 UTSW 2 177474821 splice site probably null
R2253:Zfp970 UTSW 2 177474821 splice site probably null
R4576:Zfp970 UTSW 2 177475680 missense probably damaging 0.99
R4617:Zfp970 UTSW 2 177476168 missense probably benign 0.16
R4828:Zfp970 UTSW 2 177475353 missense probably damaging 0.98
R5801:Zfp970 UTSW 2 177473358 missense probably damaging 1.00
R6198:Zfp970 UTSW 2 177475460 missense probably damaging 1.00
R6540:Zfp970 UTSW 2 177475595 missense probably damaging 1.00
R6793:Zfp970 UTSW 2 177475545 missense probably damaging 1.00
R7092:Zfp970 UTSW 2 177475292 missense probably damaging 1.00
R7289:Zfp970 UTSW 2 177475293 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTCCAAGGACATGAGCGAA -3'
(R):5'- GTATTTGAAGGTCACCACTTCTTAT -3'

Sequencing Primer
(F):5'- CAATGTGGTAAAGCCTTTGCAC -3'
(R):5'- CACATTGCTTACATTCACAGGG -3'
Posted On2015-01-13