Incidental Mutation 'R1744:Sp110'
ID258016
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 039776-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.651) question?
Stock #R1744 (G1)
Quality Score21
Status Validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 85594372 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 70 (T70S)
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
AA Change: T70S

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034
AA Change: T70S

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162784
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 A G 5: 81,794,420 E1247G probably damaging Het
Bcl2l15 T A 3: 103,838,540 L165Q probably damaging Het
Cd163 C A 6: 124,307,028 A53E possibly damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clca3a1 G T 3: 144,746,835 A629D probably damaging Het
Csde1 T A 3: 103,050,315 S463R probably benign Het
Cth C G 3: 157,906,268 R304P probably damaging Het
D7Ertd443e A G 7: 134,349,413 V177A probably benign Het
Ddx56 G A 11: 6,266,396 R189W probably damaging Het
Dennd2a A T 6: 39,480,251 F752L probably benign Het
Gabrp A T 11: 33,572,462 V28E probably benign Het
Gpam T C 19: 55,074,591 E763G probably damaging Het
Hars G A 18: 36,770,832 R266C probably benign Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2d T C 15: 98,865,047 K281E probably damaging Het
Lbx1 T C 19: 45,234,213 K124E probably damaging Het
Lcp2 T C 11: 34,069,911 probably null Het
Mab21l2 T C 3: 86,546,904 E263G possibly damaging Het
Macf1 A T 4: 123,475,853 I140K probably damaging Het
Mcemp1 G A 8: 3,666,054 A20T probably damaging Het
Met T C 6: 17,540,646 V137A possibly damaging Het
Mgat5 T C 1: 127,479,469 F624S probably damaging Het
Nutm2 T C 13: 50,469,354 I29T probably benign Het
Ociad1 T C 5: 73,300,719 probably null Het
Ogfod2 G A 5: 124,114,156 probably null Het
Olfr816 A C 10: 129,911,393 V295G probably damaging Het
Olfr967 A C 9: 39,750,415 T10P probably benign Het
Otoa G A 7: 121,127,776 probably benign Het
Otud3 A C 4: 138,895,748 L394R probably damaging Het
Pde5a T C 3: 122,747,897 V12A probably damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prr27 A G 5: 87,843,047 I173V possibly damaging Het
Psg29 T C 7: 17,210,353 C263R probably damaging Het
Ptprm T C 17: 66,689,366 Y1242C probably damaging Het
Retsat C T 6: 72,606,575 R84* probably null Het
Rif1 G A 2: 52,112,392 V1953I possibly damaging Het
Ros1 A T 10: 52,123,379 N1137K probably damaging Het
Scn1a T C 2: 66,322,276 H787R probably benign Het
Sec16a T C 2: 26,439,186 E939G probably damaging Het
Sh2d4a G A 8: 68,331,155 G247D possibly damaging Het
Siglec1 A G 2: 131,081,299 S509P probably damaging Het
Slc25a30 A G 14: 75,763,330 I278T probably damaging Het
Slc6a20a C T 9: 123,662,993 V104I probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stxbp1 A G 2: 32,806,719 probably null Het
Tmem132b T C 5: 125,778,844 probably null Het
Tmem2 C A 19: 21,832,137 Y960* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc6a A G 7: 19,514,229 E38G probably damaging Het
Trps1 T C 15: 50,661,213 D857G probably damaging Het
Tspear T A 10: 77,864,884 probably null Het
Vmn1r23 A T 6: 57,925,925 N289K possibly damaging Het
Zcchc8 G A 5: 123,700,373 Q701* probably null Het
Zfp618 A T 4: 63,086,634 probably benign Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5383:Sp110 UTSW 1 85591569 frame shift probably null
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCTTTTACTGTAGCACCACTGCAC -3'
(R):5'- GCAGACACTGGAAGAATTTTGCAGC -3'

Sequencing Primer
(F):5'- ACATGTGACAAGGATCTCGG -3'
(R):5'- gcctgtctcctgaatgctg -3'
Posted On2015-01-14