Mutagenetix > Incidental Mutation

Incidental Mutation 'R1846:Mroh2a'

258034

Institutional Source

Beutler Lab

Gene Symbol

Mroh2a

Ensembl Gene

ENSMUSG00000079429

Gene Name

maestro heat-like repeat family member 2A

Synonyms

Heatr7b1, ENSMUSG00000044873, OTTMUSG00000020804

MMRRC Submission

039871-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R1846 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

88226986-88262289 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 88258664 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 64 (S64G)

Ref Sequence

ENSEMBL: ENSMUSP00000118971 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000113130] [ENSMUST00000135948]

AlphaFold

D3Z750

Predicted Effect

probably benign
Transcript: ENSMUST00000054674

SMART Domains

Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

Domain	Start	End	E-Value	Type
Pfam:Scm3	11	68	1.5e-10	PFAM
low complexity region	159	175	N/A	INTRINSIC
low complexity region	215	232	N/A	INTRINSIC
Pfam:HJURP_mid	254	370	7.6e-54	PFAM
Pfam:HJURP_C	385	446	3.1e-26	PFAM
low complexity region	496	515	N/A	INTRINSIC
Pfam:HJURP_C	527	585	7.1e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000061013
AA Change: S1567G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429
AA Change: S1567G

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1235	1248	N/A	INTRINSIC
SCOP:d1jdha_	1371	1669	9e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113130
AA Change: S1559G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429
AA Change: S1559G

Domain	Start	End	E-Value	Type
low complexity region	9	26	N/A	INTRINSIC
low complexity region	99	112	N/A	INTRINSIC
low complexity region	1232	1245	N/A	INTRINSIC
SCOP:d1gw5a_	1446	1671	6e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135948
AA Change: S64G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000118971
Gene: ENSMUSG00000079429
AA Change: S64G

Domain	Start	End	E-Value	Type
SCOP:d1gw5a_	15	174	5e-6	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.6%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a HEAT-domain-containing protein. The function of the encoded protein has not been characterized. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011H14Rik	G	T	14: 49,235,963	L102I	probably damaging	Het
2900092C05Rik	G	A	7: 12,512,882	R63Q	probably benign	Het
Adamts20	A	T	15: 94,345,990	C619S	probably damaging	Het
Alx1	T	C	10: 103,025,304	D121G	possibly damaging	Het
Anks3	A	C	16: 4,953,884	M215R	probably benign	Het
Anxa4	T	A	6: 86,741,911		probably null	Het
Arhgef25	A	G	10: 127,185,864	V222A	probably damaging	Het
Bglap2	A	G	3: 88,378,625		probably benign	Het
Cars2	A	G	8: 11,514,674	V22A	probably benign	Het
Cenpe	T	A	3: 135,239,845	I1040N	probably damaging	Het
Cep170	C	T	1: 176,755,769	D1015N	probably damaging	Het
Chia1	T	A	3: 106,130,865	I359N	probably damaging	Het
Crot	A	T	5: 8,988,248	V93E	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnmbp	T	C	19: 43,902,747	I194V	probably damaging	Het
Dock4	T	A	12: 40,733,268	C734S	probably benign	Het
Eif4e3	T	C	6: 99,640,701	S70G	probably benign	Het
Entpd3	G	A	9: 120,558,375	D213N	probably benign	Het
Ern2	T	G	7: 122,176,536	Y445S	probably benign	Het
Fasn	A	G	11: 120,813,307	S1429P	probably benign	Het
Fat4	A	G	3: 38,982,383	I3395V	probably benign	Het
Fbln2	C	A	6: 91,256,417	Q628K	possibly damaging	Het
Fbxo28	T	C	1: 182,326,280	N164D	probably benign	Het
Fez1	T	C	9: 36,867,767	S247P	probably damaging	Het
Gars	A	G	6: 55,063,168	D360G	probably benign	Het
Gcfc2	A	T	6: 81,956,892	Q710L	probably damaging	Het
Ggt5	A	G	10: 75,610,542		probably null	Het
Glp1r	A	G	17: 30,929,935		probably null	Het
Hspa14	T	C	2: 3,491,660	D356G	possibly damaging	Het
Htt	T	A	5: 34,848,944	I1399N	probably damaging	Het
Kmt2e	G	A	5: 23,499,486		probably benign	Het
Krt36	C	A	11: 100,105,548	G17C	probably damaging	Het
Lama2	T	C	10: 27,212,096	E895G	probably damaging	Het
Lamb2	G	A	9: 108,487,387	R1142H	probably benign	Het
Lhcgr	C	T	17: 88,765,147		probably null	Het
Lpin2	A	G	17: 71,225,069	T140A	probably benign	Het
Metap1	A	G	3: 138,480,682		probably benign	Het
Mpeg1	T	C	19: 12,463,122	V648A	probably benign	Het
Muc4	T	A	16: 32,752,369	I749N	probably benign	Het
N4bp2	T	C	5: 65,808,519	F1304L	probably damaging	Het
Nup85	A	G	11: 115,568,413	E114G	probably benign	Het
Olfr1258	A	G	2: 89,930,666	T286A	possibly damaging	Het
Olfr1415	A	T	1: 92,491,100	Y218*	probably null	Het
Olfr448	A	G	6: 42,897,320	S290G	probably damaging	Het
Pafah2	GCCCC	GCCCCC	4: 134,425,541		probably null	Het
Parp2	T	A	14: 50,815,386	C145*	probably null	Het
Plpp6	T	C	19: 28,964,280	S94P	probably benign	Het
Polr1a	T	C	6: 71,976,188	I1580T	probably damaging	Het
Polrmt	A	T	10: 79,738,209	V860E	probably damaging	Het
Ppp1r17	A	G	6: 56,022,427	E15G	possibly damaging	Het
Prl7b1	A	T	13: 27,602,848	W133R	probably damaging	Het
Ptk7	A	G	17: 46,576,490		probably null	Het
Rad23b	C	T	4: 55,383,637	Q290*	probably null	Het
Rorb	C	T	19: 18,955,081	E369K	probably damaging	Het
Rusc1	T	C	3: 89,092,145	D110G	probably damaging	Het
Smg7	A	G	1: 152,848,850	S527P	probably damaging	Het
Ssbp2	C	T	13: 91,664,149	P105L	probably damaging	Het
Stt3a	C	T	9: 36,763,385	R34H	probably damaging	Het
Sufu	T	A	19: 46,450,947	I202N	possibly damaging	Het
Thsd7b	G	A	1: 129,613,256	R289Q	probably damaging	Het
Tph1	A	T	7: 46,660,439	S130T	probably damaging	Het
Ttn	A	G	2: 76,945,686	S1671P	probably damaging	Het
Usp4	A	G	9: 108,372,736	I441V	probably benign	Het
Vmn1r8	A	G	6: 57,036,428	N155D	probably benign	Het
Vmn2r115	A	C	17: 23,359,383	K610T	probably damaging	Het
Vmn2r62	G	A	7: 42,789,122	P97S	probably damaging	Het
Zbtb40	T	C	4: 137,007,839	D297G	probably benign	Het
Zfp174	C	A	16: 3,854,735	Q383K	probably benign	Het
Zfp318	T	A	17: 46,413,666	D2198E	probably benign	Het
Zfp628	C	T	7: 4,920,867	P696L	possibly damaging	Het
Zgrf1	T	A	3: 127,615,463	N1695K	probably damaging	Het

Other mutations in Mroh2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Mroh2a	APN	1	88230746	missense	probably damaging	0.99
IGL00990:Mroh2a	APN	1	88244970	missense	probably benign	0.03
IGL00990:Mroh2a	APN	1	88234120	missense	possibly damaging	0.76
IGL03097:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R0032:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0068:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0139:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R0197:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0242:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0322:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0374:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0387:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R0412:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R0536:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0548:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0580:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0581:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0583:Mroh2a	UTSW	1	88256166	frame shift	probably null
R0613:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0652:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0657:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R0659:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0659:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0671:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R0675:Mroh2a	UTSW	1	88228380	missense	probably damaging	0.99
R0675:Mroh2a	UTSW	1	88250342	missense	probably damaging	1.00
R0689:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0689:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0735:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0761:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R0766:Mroh2a	UTSW	1	88230680	nonsense	probably null
R0845:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0853:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R0959:Mroh2a	UTSW	1	88232257	frame shift	probably null
R0960:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1004:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1013:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1028:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1268:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1281:Mroh2a	UTSW	1	88256167	frame shift	probably null
R1414:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R1439:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1441:Mroh2a	UTSW	1	88241631	missense	possibly damaging	0.93
R1442:Mroh2a	UTSW	1	88232353	splice site	probably benign
R1442:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R1465:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R1662:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R1686:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1686:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R1780:Mroh2a	UTSW	1	88230680	nonsense	probably null
R1899:Mroh2a	UTSW	1	88235376	missense	probably benign	0.30
R1958:Mroh2a	UTSW	1	88237491	nonsense	probably null
R2122:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2248:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R2306:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R2869:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2870:Mroh2a	UTSW	1	88232257	frame shift	probably null
R2871:Mroh2a	UTSW	1	88255565	missense	probably damaging	1.00
R2872:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3408:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3608:Mroh2a	UTSW	1	88244995	missense	probably damaging	1.00
R3730:Mroh2a	UTSW	1	88232257	frame shift	probably null
R3937:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4022:Mroh2a	UTSW	1	88246042	missense	probably damaging	1.00
R4049:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4133:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4361:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4392:Mroh2a	UTSW	1	88259589	missense	probably damaging	1.00
R4401:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4402:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4575:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4625:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R4631:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4665:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R4701:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R4701:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R4771:Mroh2a	UTSW	1	88251365	missense	probably damaging	1.00
R4795:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R4839:Mroh2a	UTSW	1	88237944	missense	probably damaging	1.00
R4873:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4875:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R4896:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R5007:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5031:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5062:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5301:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5367:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5371:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5446:Mroh2a	UTSW	1	88254965	missense	possibly damaging	0.95
R5484:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5506:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5561:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5615:Mroh2a	UTSW	1	88232257	frame shift	probably null
R5825:Mroh2a	UTSW	1	88230680	nonsense	probably null
R5891:Mroh2a	UTSW	1	88241615	missense	possibly damaging	0.93
R5906:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R5928:Mroh2a	UTSW	1	88241618	missense	probably benign	0.07
R6004:Mroh2a	UTSW	1	88248655	missense	probably damaging	1.00
R6035:Mroh2a	UTSW	1	88230668	missense	probably damaging	1.00
R6064:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6074:Mroh2a	UTSW	1	88258664	missense	probably benign	0.00
R6091:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6127:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R6234:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6244:Mroh2a	UTSW	1	88256754	missense	probably benign	0.37
R6464:Mroh2a	UTSW	1	88257802	missense	probably damaging	1.00
R6465:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6575:Mroh2a	UTSW	1	88232257	frame shift	probably null
R6809:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
R6819:Mroh2a	UTSW	1	88242420	missense	possibly damaging	0.77
R6854:Mroh2a	UTSW	1	88243950	missense	probably damaging	1.00
R6860:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7126:Mroh2a	UTSW	1	88254935	missense	possibly damaging	0.72
R7818:Mroh2a	UTSW	1	88234612	critical splice donor site	probably null
R8350:Mroh2a	UTSW	1	88244083	splice site	probably null
R9414:Mroh2a	UTSW	1	88251374	missense	probably benign	0.26
RF024:Mroh2a	UTSW	1	88242485	missense	probably damaging	1.00
V5622:Mroh2a	UTSW	1	88227091	start gained	probably benign
V8831:Mroh2a	UTSW	1	88256167	frame shift	probably null
X0027:Mroh2a	UTSW	1	88248613	missense	possibly damaging	0.86
X0028:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0028:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0033:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0034:Mroh2a	UTSW	1	88232292	missense	probably damaging	1.00
X0034:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0039:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88232257	frame shift	probably null
X0057:Mroh2a	UTSW	1	88255655	missense	probably benign	0.25
X0057:Mroh2a	UTSW	1	88256166	frame shift	probably null
X0063:Mroh2a	UTSW	1	88232257	frame shift	probably null
Z1188:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01
Z1190:Mroh2a	UTSW	1	88232257	frame shift	probably null
Z1192:Mroh2a	UTSW	1	88235216	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCTGTAGAGCCCTTTCTGG -3'
(R):5'- AAAGAGCATTCCTTCCTGTCAGG -3'

Sequencing Primer
(F):5'- TGGGGCTGCTCTCTCTC -3'
(R):5'- ACCTTCCTGGACTTTGAAGATTG -3'

Posted On

2015-01-16