Incidental Mutation 'R3159:Cdk15'
ID258046
Institutional Source Beutler Lab
Gene Symbol Cdk15
Ensembl Gene ENSMUSG00000026023
Gene Namecyclin-dependent kinase 15
SynonymsAls2cr7, Pftk2
MMRRC Submission 040610-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3159 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59256906-59352993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59301281 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 313 (I313T)
Ref Sequence ENSEMBL: ENSMUSP00000124680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114248] [ENSMUST00000160662]
Predicted Effect probably damaging
Transcript: ENSMUST00000114248
AA Change: I311T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109886
Gene: ENSMUSG00000026023
AA Change: I311T

DomainStartEndE-ValueType
S_TKc 101 385 7.9e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160662
AA Change: I313T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124680
Gene: ENSMUSG00000026023
AA Change: I313T

DomainStartEndE-ValueType
S_TKc 103 387 7.9e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162906
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,415 V1931A probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Celsr3 T C 9: 108,827,710 V464A possibly damaging Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm5145 A G 17: 20,570,893 I178V probably benign Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmgcr C T 13: 96,665,847 V110I probably damaging Het
Hsd17b2 A C 8: 117,758,752 D318A probably damaging Het
Ighv8-6 A G 12: 115,165,888 S83P probably damaging Het
Isg20 C A 7: 78,914,453 A36E possibly damaging Het
Jade3 A G X: 20,479,544 K54E probably damaging Het
Mark1 A T 1: 184,908,387 Y505N probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1086 A G 2: 86,676,511 I274T probably benign Het
Pcdha2 C T 18: 36,941,197 T627I probably damaging Het
Polg2 A C 11: 106,768,337 V450G probably benign Het
Rbm48 A T 5: 3,596,105 V33D possibly damaging Het
Rfx6 A T 10: 51,726,720 R778W probably damaging Het
Sav1 A T 12: 69,984,552 D65E probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Shank2 C A 7: 144,081,874 N328K probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Slit1 A G 19: 41,604,373 Y1214H probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Tgfb3 A T 12: 86,058,986 W332R probably damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav4-4-dv10 A T 14: 53,684,102 K86* probably null Het
Zfp667 T C 7: 6,306,000 C556R probably damaging Het
Zranb3 A G 1: 127,972,949 I713T probably benign Het
Other mutations in Cdk15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Cdk15 APN 1 59287796 missense probably benign 0.37
IGL01612:Cdk15 APN 1 59289773 missense possibly damaging 0.93
IGL02179:Cdk15 APN 1 59330941 missense possibly damaging 0.84
IGL03228:Cdk15 APN 1 59258753 missense possibly damaging 0.95
FR4449:Cdk15 UTSW 1 59257823 small insertion probably benign
R0270:Cdk15 UTSW 1 59310806 missense probably damaging 0.99
R1720:Cdk15 UTSW 1 59289758 missense probably damaging 1.00
R1958:Cdk15 UTSW 1 59344316 missense probably damaging 0.99
R1969:Cdk15 UTSW 1 59330951 missense probably damaging 1.00
R6000:Cdk15 UTSW 1 59289659 missense probably damaging 1.00
R6226:Cdk15 UTSW 1 59265633 missense probably damaging 1.00
R6257:Cdk15 UTSW 1 59257105 critical splice donor site probably null
R7184:Cdk15 UTSW 1 59265655 missense probably benign 0.33
R7446:Cdk15 UTSW 1 59289695 missense probably damaging 1.00
R7467:Cdk15 UTSW 1 59289779 missense probably null 0.96
R7588:Cdk15 UTSW 1 59344299 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCCCAGCGTTTCTCAGAAG -3'
(R):5'- CGTTAGTGGGGAGACTTAATAGGC -3'

Sequencing Primer
(F):5'- CAGCGTTTCTCAGAAGGAGGC -3'
(R):5'- GAGTTTCCTAATGACTCATCCGGAAG -3'
Posted On2015-01-23