Incidental Mutation 'R3159:Olfr1086'
ID258049
Institutional Source Beutler Lab
Gene Symbol Olfr1086
Ensembl Gene ENSMUSG00000075175
Gene Nameolfactory receptor 1086
SynonymsGA_x6K02T2Q125-48168771-48167839, MOR179-2
MMRRC Submission 040610-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3159 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86676218-86680092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86676511 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 274 (I274T)
Ref Sequence ENSEMBL: ENSMUSP00000150094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099878] [ENSMUST00000213198]
Predicted Effect probably benign
Transcript: ENSMUST00000099878
AA Change: I274T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097463
Gene: ENSMUSG00000075175
AA Change: I274T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 3.3e-49 PFAM
Pfam:7tm_1 39 288 1.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213198
AA Change: I274T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,415 V1931A probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cdk15 T C 1: 59,301,281 I313T probably damaging Het
Celsr3 T C 9: 108,827,710 V464A possibly damaging Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm5145 A G 17: 20,570,893 I178V probably benign Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmgcr C T 13: 96,665,847 V110I probably damaging Het
Hsd17b2 A C 8: 117,758,752 D318A probably damaging Het
Ighv8-6 A G 12: 115,165,888 S83P probably damaging Het
Isg20 C A 7: 78,914,453 A36E possibly damaging Het
Jade3 A G X: 20,479,544 K54E probably damaging Het
Mark1 A T 1: 184,908,387 Y505N probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Pcdha2 C T 18: 36,941,197 T627I probably damaging Het
Polg2 A C 11: 106,768,337 V450G probably benign Het
Rbm48 A T 5: 3,596,105 V33D possibly damaging Het
Rfx6 A T 10: 51,726,720 R778W probably damaging Het
Sav1 A T 12: 69,984,552 D65E probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Shank2 C A 7: 144,081,874 N328K probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Slit1 A G 19: 41,604,373 Y1214H probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Tgfb3 A T 12: 86,058,986 W332R probably damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav4-4-dv10 A T 14: 53,684,102 K86* probably null Het
Zfp667 T C 7: 6,306,000 C556R probably damaging Het
Zranb3 A G 1: 127,972,949 I713T probably benign Het
Other mutations in Olfr1086
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Olfr1086 APN 2 86677081 missense probably benign 0.00
R0492:Olfr1086 UTSW 2 86676490 missense probably damaging 1.00
R0629:Olfr1086 UTSW 2 86676529 missense possibly damaging 0.65
R1114:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R1341:Olfr1086 UTSW 2 86677163 missense possibly damaging 0.86
R1868:Olfr1086 UTSW 2 86677285 missense possibly damaging 0.72
R2183:Olfr1086 UTSW 2 86677036 missense probably benign 0.21
R4061:Olfr1086 UTSW 2 86676818 missense probably damaging 1.00
R4420:Olfr1086 UTSW 2 86676919 missense possibly damaging 0.95
R5514:Olfr1086 UTSW 2 86676881 missense probably benign 0.03
R7066:Olfr1086 UTSW 2 86677226 missense possibly damaging 0.95
R7077:Olfr1086 UTSW 2 86676892 missense possibly damaging 0.78
R7246:Olfr1086 UTSW 2 86677289 missense probably benign 0.11
R7383:Olfr1086 UTSW 2 86676919 missense possibly damaging 0.95
R8062:Olfr1086 UTSW 2 86677066 missense probably benign 0.01
X0064:Olfr1086 UTSW 2 86677199 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGGAGAGGCATTAACTAATACCTTTC -3'
(R):5'- GATTGTCCTGCTGTCCTATGGC -3'

Sequencing Primer
(F):5'- TGATGAACAAAAGGAACATTTTCAAC -3'
(R):5'- GCTGTCCTATGGCTTCATTTTG -3'
Posted On2015-01-23