Incidental Mutation 'R3159:Ociad1'
ID258056
Institutional Source Beutler Lab
Gene Symbol Ociad1
Ensembl Gene ENSMUSG00000029152
Gene NameOCIA domain containing 1
SynonymsB230209J16Rik, Emi2, TPA018, 6030432N09Rik, Imi2, expressed during mesenchymal induction 2, Asrij
MMRRC Submission 040610-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3159 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73292784-73314069 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 73310345 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 155 (R155*)
Ref Sequence ENSEMBL: ENSMUSP00000144102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031038] [ENSMUST00000071081] [ENSMUST00000166823] [ENSMUST00000200935] [ENSMUST00000201556] [ENSMUST00000201739] [ENSMUST00000202237] [ENSMUST00000202250]
Predicted Effect probably null
Transcript: ENSMUST00000031038
AA Change: R209*
SMART Domains Protein: ENSMUSP00000031038
Gene: ENSMUSG00000029152
AA Change: R209*

DomainStartEndE-ValueType
Pfam:OCIA 8 112 8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071081
SMART Domains Protein: ENSMUSP00000069412
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 3 112 8.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166823
SMART Domains Protein: ENSMUSP00000128805
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 3 112 8.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200935
SMART Domains Protein: ENSMUSP00000144515
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 4.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201272
Predicted Effect probably benign
Transcript: ENSMUST00000201556
SMART Domains Protein: ENSMUSP00000144227
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201739
Predicted Effect probably null
Transcript: ENSMUST00000202237
AA Change: R155*
SMART Domains Protein: ENSMUSP00000144102
Gene: ENSMUSG00000029152
AA Change: R155*

DomainStartEndE-ValueType
Pfam:OCIA 1 58 1.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202250
SMART Domains Protein: ENSMUSP00000143799
Gene: ENSMUSG00000029152

DomainStartEndE-ValueType
Pfam:OCIA 8 112 4.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202887
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,415 V1931A probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cdk15 T C 1: 59,301,281 I313T probably damaging Het
Celsr3 T C 9: 108,827,710 V464A possibly damaging Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm5145 A G 17: 20,570,893 I178V probably benign Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmgcr C T 13: 96,665,847 V110I probably damaging Het
Hsd17b2 A C 8: 117,758,752 D318A probably damaging Het
Ighv8-6 A G 12: 115,165,888 S83P probably damaging Het
Isg20 C A 7: 78,914,453 A36E possibly damaging Het
Jade3 A G X: 20,479,544 K54E probably damaging Het
Mark1 A T 1: 184,908,387 Y505N probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Olfr1086 A G 2: 86,676,511 I274T probably benign Het
Pcdha2 C T 18: 36,941,197 T627I probably damaging Het
Polg2 A C 11: 106,768,337 V450G probably benign Het
Rbm48 A T 5: 3,596,105 V33D possibly damaging Het
Rfx6 A T 10: 51,726,720 R778W probably damaging Het
Sav1 A T 12: 69,984,552 D65E probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Shank2 C A 7: 144,081,874 N328K probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Slit1 A G 19: 41,604,373 Y1214H probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Tgfb3 A T 12: 86,058,986 W332R probably damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav4-4-dv10 A T 14: 53,684,102 K86* probably null Het
Zfp667 T C 7: 6,306,000 C556R probably damaging Het
Zranb3 A G 1: 127,972,949 I713T probably benign Het
Other mutations in Ociad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ociad1 APN 5 73304543 splice site probably benign
IGL00801:Ociad1 APN 5 73304566 missense probably damaging 1.00
IGL02402:Ociad1 APN 5 73300694 missense possibly damaging 0.72
IGL03197:Ociad1 APN 5 73294332 missense probably benign 0.00
Bequerel UTSW 5 73310382 missense probably benign 0.01
Curie UTSW 5 73310345 nonsense probably null
R0420:Ociad1 UTSW 5 73313429 splice site probably null
R0707:Ociad1 UTSW 5 73294912 splice site probably benign
R1130:Ociad1 UTSW 5 73294332 missense probably benign 0.00
R1744:Ociad1 UTSW 5 73300719 critical splice donor site probably null
R2848:Ociad1 UTSW 5 73294351 splice site probably null
R3157:Ociad1 UTSW 5 73310345 nonsense probably null
R4686:Ociad1 UTSW 5 73306735 missense possibly damaging 0.77
R5002:Ociad1 UTSW 5 73310316 missense possibly damaging 0.82
R5398:Ociad1 UTSW 5 73310412 missense probably benign 0.00
R5483:Ociad1 UTSW 5 73294971 missense probably damaging 1.00
R5921:Ociad1 UTSW 5 73310382 missense probably benign 0.01
R7220:Ociad1 UTSW 5 73313466 missense probably benign 0.00
R7511:Ociad1 UTSW 5 73294995 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTCTAGTATCTTGGAATGGT -3'
(R):5'- TCAAATGTTGTGTGTTGCATCA -3'

Sequencing Primer
(F):5'- ATCTTGGAATGGTAGCAATAGTTTG -3'
(R):5'- CTAAACGCAGGTCATCAGGCTTG -3'
Posted On2015-01-23