Incidental Mutation 'R3159:Dmpk'
ID258059
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
MMRRC Submission 040610-MU
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R3159 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19093019 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 579 (T579A)
Ref Sequence ENSEMBL: ENSMUSP00000104114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000049454] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
AA Change: T605A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: T605A

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049454
SMART Domains Protein: ENSMUSP00000045973
Gene: ENSMUSG00000040841

DomainStartEndE-ValueType
coiled coil region 14 48 N/A INTRINSIC
Pfam:SIX1_SD 79 189 1.4e-43 PFAM
HOX 194 256 3.11e-14 SMART
low complexity region 300 313 N/A INTRINSIC
low complexity region 347 358 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
low complexity region 564 574 N/A INTRINSIC
low complexity region 620 639 N/A INTRINSIC
low complexity region 674 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
AA Change: T579A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: T579A

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect probably benign
Transcript: ENSMUST00000154199
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,415 V1931A probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cdk15 T C 1: 59,301,281 I313T probably damaging Het
Celsr3 T C 9: 108,827,710 V464A possibly damaging Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm5145 A G 17: 20,570,893 I178V probably benign Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmgcr C T 13: 96,665,847 V110I probably damaging Het
Hsd17b2 A C 8: 117,758,752 D318A probably damaging Het
Ighv8-6 A G 12: 115,165,888 S83P probably damaging Het
Isg20 C A 7: 78,914,453 A36E possibly damaging Het
Jade3 A G X: 20,479,544 K54E probably damaging Het
Mark1 A T 1: 184,908,387 Y505N probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1086 A G 2: 86,676,511 I274T probably benign Het
Pcdha2 C T 18: 36,941,197 T627I probably damaging Het
Polg2 A C 11: 106,768,337 V450G probably benign Het
Rbm48 A T 5: 3,596,105 V33D possibly damaging Het
Rfx6 A T 10: 51,726,720 R778W probably damaging Het
Sav1 A T 12: 69,984,552 D65E probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Shank2 C A 7: 144,081,874 N328K probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Slit1 A G 19: 41,604,373 Y1214H probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Tgfb3 A T 12: 86,058,986 W332R probably damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav4-4-dv10 A T 14: 53,684,102 K86* probably null Het
Zfp667 T C 7: 6,306,000 C556R probably damaging Het
Zranb3 A G 1: 127,972,949 I713T probably benign Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0388:Dmpk UTSW 7 19084077 unclassified probably benign
R0961:Dmpk UTSW 7 19087270 missense probably damaging 0.99
R3103:Dmpk UTSW 7 19087654 missense probably damaging 1.00
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4830:Dmpk UTSW 7 19087528 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5170:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5172:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5200:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5383:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
R8032:Dmpk UTSW 7 19088053 missense possibly damaging 0.63
R8234:Dmpk UTSW 7 19088123 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTAAGTAGCCAATGACGAGTTCCAAC -3'
(R):5'- ATGGGCACAGAGACGCTTTG -3'

Sequencing Primer
(F):5'- TCTTGCGAGCAGACCAACTTTAG -3'
(R):5'- ACGCTTTGGGTCGCTCC -3'
Posted On2015-01-23