Incidental Mutation 'R3159:Hsd17b2'
ID258063
Institutional Source Beutler Lab
Gene Symbol Hsd17b2
Ensembl Gene ENSMUSG00000031844
Gene Namehydroxysteroid (17-beta) dehydrogenase 2
Synonyms17 HSD type 2
MMRRC Submission 040610-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3159 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location117701904-117759027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 117758752 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 318 (D318A)
Ref Sequence ENSEMBL: ENSMUSP00000034304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034304]
Predicted Effect probably damaging
Transcript: ENSMUST00000034304
AA Change: D318A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034304
Gene: ENSMUSG00000031844
AA Change: D318A

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
transmembrane domain 40 62 N/A INTRINSIC
Pfam:adh_short 84 279 1.3e-48 PFAM
Pfam:KR 85 263 3.6e-7 PFAM
Pfam:DUF1776 85 361 3.2e-13 PFAM
Pfam:adh_short_C2 89 288 1.5e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality starting at E11.5 and placenta defects. The few mutants that survive to birth exhibit enlarged brain ventricles, cerebral cortex abnormalities and a single kidney. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,415 V1931A probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cdk15 T C 1: 59,301,281 I313T probably damaging Het
Celsr3 T C 9: 108,827,710 V464A possibly damaging Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm5145 A G 17: 20,570,893 I178V probably benign Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmgcr C T 13: 96,665,847 V110I probably damaging Het
Ighv8-6 A G 12: 115,165,888 S83P probably damaging Het
Isg20 C A 7: 78,914,453 A36E possibly damaging Het
Jade3 A G X: 20,479,544 K54E probably damaging Het
Mark1 A T 1: 184,908,387 Y505N probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1086 A G 2: 86,676,511 I274T probably benign Het
Pcdha2 C T 18: 36,941,197 T627I probably damaging Het
Polg2 A C 11: 106,768,337 V450G probably benign Het
Rbm48 A T 5: 3,596,105 V33D possibly damaging Het
Rfx6 A T 10: 51,726,720 R778W probably damaging Het
Sav1 A T 12: 69,984,552 D65E probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Shank2 C A 7: 144,081,874 N328K probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Slit1 A G 19: 41,604,373 Y1214H probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Tgfb3 A T 12: 86,058,986 W332R probably damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav4-4-dv10 A T 14: 53,684,102 K86* probably null Het
Zfp667 T C 7: 6,306,000 C556R probably damaging Het
Zranb3 A G 1: 127,972,949 I713T probably benign Het
Other mutations in Hsd17b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Hsd17b2 APN 8 117758671 missense probably damaging 0.98
IGL00907:Hsd17b2 APN 8 117734694 missense probably benign 0.00
R0664:Hsd17b2 UTSW 8 117758701 missense possibly damaging 0.67
R1506:Hsd17b2 UTSW 8 117702265 critical splice donor site probably null
R1627:Hsd17b2 UTSW 8 117702170 missense possibly damaging 0.53
R1822:Hsd17b2 UTSW 8 117758749 missense possibly damaging 0.47
R1930:Hsd17b2 UTSW 8 117758904 missense possibly damaging 0.56
R2055:Hsd17b2 UTSW 8 117702174 missense possibly damaging 0.96
R6536:Hsd17b2 UTSW 8 117702182 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCATCTGAGCCTTGCTTTC -3'
(R):5'- GAATGTGACATTCCCCACCC -3'

Sequencing Primer
(F):5'- CTTCTTGTGTTCCAGACATCACAGG -3'
(R):5'- AGTGCACTGTCCTTAAAGCTC -3'
Posted On2015-01-23