Incidental Mutation 'R3159:Ccr4'
ID258065
Institutional Source Beutler Lab
Gene Symbol Ccr4
Ensembl Gene ENSMUSG00000047898
Gene Namechemokine (C-C motif) receptor 4
SynonymsCC CKR-4, Cmkbr4
MMRRC Submission 040610-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3159 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location114490316-114504916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114492282 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 238 (N238K)
Ref Sequence ENSEMBL: ENSMUSP00000150002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054414] [ENSMUST00000215425] [ENSMUST00000215959]
Predicted Effect probably benign
Transcript: ENSMUST00000054414
AA Change: N238K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000062677
Gene: ENSMUSG00000047898
AA Change: N238K

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:7TM_GPCR_Srsx 50 319 2.9e-11 PFAM
Pfam:7tm_1 56 304 3.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215425
AA Change: N238K

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably benign
Transcript: ENSMUST00000215959
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein-coupled receptor family . It is a receptor for the CC chemokine - MIP-1, RANTES, TARC and MCP-1. Chemokines are a group of small polypeptide, structurally related molecules that regulate cell trafficking of various types of leukocytes. The chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in decreased mortality, decreased tumor necrosis factor production, and decreased IL-1beta production following LPS administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,415 V1931A probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Cdk15 T C 1: 59,301,281 I313T probably damaging Het
Celsr3 T C 9: 108,827,710 V464A possibly damaging Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm5145 A G 17: 20,570,893 I178V probably benign Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmgcr C T 13: 96,665,847 V110I probably damaging Het
Hsd17b2 A C 8: 117,758,752 D318A probably damaging Het
Ighv8-6 A G 12: 115,165,888 S83P probably damaging Het
Isg20 C A 7: 78,914,453 A36E possibly damaging Het
Jade3 A G X: 20,479,544 K54E probably damaging Het
Mark1 A T 1: 184,908,387 Y505N probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1086 A G 2: 86,676,511 I274T probably benign Het
Pcdha2 C T 18: 36,941,197 T627I probably damaging Het
Polg2 A C 11: 106,768,337 V450G probably benign Het
Rbm48 A T 5: 3,596,105 V33D possibly damaging Het
Rfx6 A T 10: 51,726,720 R778W probably damaging Het
Sav1 A T 12: 69,984,552 D65E probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Shank2 C A 7: 144,081,874 N328K probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Slit1 A G 19: 41,604,373 Y1214H probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Tgfb3 A T 12: 86,058,986 W332R probably damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav4-4-dv10 A T 14: 53,684,102 K86* probably null Het
Zfp667 T C 7: 6,306,000 C556R probably damaging Het
Zranb3 A G 1: 127,972,949 I713T probably benign Het
Other mutations in Ccr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02625:Ccr4 APN 9 114492333 missense probably damaging 1.00
kentucky UTSW 9 114492646 missense probably damaging 1.00
P4748:Ccr4 UTSW 9 114492838 missense probably damaging 1.00
PIT4651001:Ccr4 UTSW 9 114492193 missense probably benign 0.08
R1117:Ccr4 UTSW 9 114492017 missense probably benign 0.00
R1542:Ccr4 UTSW 9 114492005 missense probably benign
R1954:Ccr4 UTSW 9 114492685 missense probably damaging 0.99
R2047:Ccr4 UTSW 9 114492565 missense probably damaging 1.00
R3157:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R3158:Ccr4 UTSW 9 114492282 missense probably benign 0.04
R4868:Ccr4 UTSW 9 114492833 missense probably benign
R5051:Ccr4 UTSW 9 114492646 missense probably damaging 1.00
R6102:Ccr4 UTSW 9 114496493 splice site probably null
R6475:Ccr4 UTSW 9 114492979 missense probably benign 0.00
R6661:Ccr4 UTSW 9 114495963 intron probably benign
R7241:Ccr4 UTSW 9 114492956 missense probably benign
R7394:Ccr4 UTSW 9 114491926 missense probably benign
Z1177:Ccr4 UTSW 9 114492839 missense not run
Predicted Primers PCR Primer
(F):5'- ATGAAGGCCAGGGTTTCTGTAG -3'
(R):5'- ATCACCAGCCTGATCACGTG -3'

Sequencing Primer
(F):5'- AGGGTTTCTGTAGCCTGGATG -3'
(R):5'- AGCCTGATCACGTGGTCAGTG -3'
Posted On2015-01-23