Incidental Mutation 'R3159:Hmgcr'
ID258075
Institutional Source Beutler Lab
Gene Symbol Hmgcr
Ensembl Gene ENSMUSG00000021670
Gene Name3-hydroxy-3-methylglutaryl-Coenzyme A reductase
SynonymsHMG-CoAR, 3-hydroxy-3-methylglutaryl-CoA reductase, Red
MMRRC Submission 040610-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3159 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location96648967-96670936 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96665847 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 110 (V110I)
Ref Sequence ENSEMBL: ENSMUSP00000022176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022176] [ENSMUST00000168855] [ENSMUST00000169196] [ENSMUST00000169966] [ENSMUST00000170287] [ENSMUST00000171537]
Predicted Effect probably damaging
Transcript: ENSMUST00000022176
AA Change: V110I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022176
Gene: ENSMUSG00000021670
AA Change: V110I

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 342 2.7e-11 PFAM
Pfam:Sterol-sensing 85 234 3.4e-20 PFAM
Pfam:HMG-CoA_red 490 870 2.2e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168374
Predicted Effect probably benign
Transcript: ENSMUST00000168855
Predicted Effect probably benign
Transcript: ENSMUST00000169196
AA Change: V110I

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132749
Gene: ENSMUSG00000021670
AA Change: V110I

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Pfam:Sterol-sensing 85 210 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169966
SMART Domains Protein: ENSMUSP00000128294
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170287
AA Change: V110I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128939
Gene: ENSMUSG00000021670
AA Change: V110I

DomainStartEndE-ValueType
transmembrane domain 20 37 N/A INTRINSIC
Pfam:Patched 56 347 1.4e-11 PFAM
Pfam:Sterol-sensing 85 234 7.4e-20 PFAM
Pfam:HMG-CoA_red 488 819 1.3e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171537
SMART Domains Protein: ENSMUSP00000126959
Gene: ENSMUSG00000021670

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 67 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172440
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HMG-CoA reductase is the rate-limiting enzyme for cholesterol synthesis and is regulated via a negative feedback mechanism mediated by sterols and non-sterol metabolites derived from mevalonate, the product of the reaction catalyzed by reductase. Normally in mammalian cells this enzyme is suppressed by cholesterol derived from the internalization and degradation of low density lipoprotein (LDL) via the LDL receptor. Competitive inhibitors of the reductase induce the expression of LDL receptors in the liver, which in turn increases the catabolism of plasma LDL and lowers the plasma concentration of cholesterol, an important determinant of atherosclerosis. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Inactivation of both copies of this gene results in early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,415 V1931A probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cdk15 T C 1: 59,301,281 I313T probably damaging Het
Celsr3 T C 9: 108,827,710 V464A possibly damaging Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm5145 A G 17: 20,570,893 I178V probably benign Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hsd17b2 A C 8: 117,758,752 D318A probably damaging Het
Ighv8-6 A G 12: 115,165,888 S83P probably damaging Het
Isg20 C A 7: 78,914,453 A36E possibly damaging Het
Jade3 A G X: 20,479,544 K54E probably damaging Het
Mark1 A T 1: 184,908,387 Y505N probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1086 A G 2: 86,676,511 I274T probably benign Het
Pcdha2 C T 18: 36,941,197 T627I probably damaging Het
Polg2 A C 11: 106,768,337 V450G probably benign Het
Rbm48 A T 5: 3,596,105 V33D possibly damaging Het
Rfx6 A T 10: 51,726,720 R778W probably damaging Het
Sav1 A T 12: 69,984,552 D65E probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Shank2 C A 7: 144,081,874 N328K probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Slit1 A G 19: 41,604,373 Y1214H probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Tgfb3 A T 12: 86,058,986 W332R probably damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav4-4-dv10 A T 14: 53,684,102 K86* probably null Het
Zfp667 T C 7: 6,306,000 C556R probably damaging Het
Zranb3 A G 1: 127,972,949 I713T probably benign Het
Other mutations in Hmgcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Hmgcr APN 13 96659278 missense probably benign
IGL01369:Hmgcr APN 13 96666522 missense probably null 1.00
IGL01575:Hmgcr APN 13 96656595 missense possibly damaging 0.56
IGL02183:Hmgcr APN 13 96663127 missense probably damaging 1.00
IGL02515:Hmgcr APN 13 96666512 splice site probably benign
IGL02716:Hmgcr APN 13 96660012 critical splice acceptor site probably null
IGL03278:Hmgcr APN 13 96656762 splice site probably benign
IGL03367:Hmgcr APN 13 96665853 missense probably damaging 0.98
PIT4131001:Hmgcr UTSW 13 96659054 missense probably damaging 1.00
PIT4504001:Hmgcr UTSW 13 96663097 missense possibly damaging 0.95
R0003:Hmgcr UTSW 13 96652145 missense probably damaging 1.00
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0017:Hmgcr UTSW 13 96652089 splice site probably benign
R0217:Hmgcr UTSW 13 96651980 missense probably damaging 1.00
R0511:Hmgcr UTSW 13 96660143 unclassified probably null
R0707:Hmgcr UTSW 13 96650643 unclassified probably benign
R1301:Hmgcr UTSW 13 96659020 missense probably damaging 0.97
R2203:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2204:Hmgcr UTSW 13 96656633 missense probably damaging 1.00
R2433:Hmgcr UTSW 13 96665885 missense probably damaging 1.00
R2938:Hmgcr UTSW 13 96663068 missense probably damaging 0.99
R3737:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R3752:Hmgcr UTSW 13 96663116 missense probably damaging 1.00
R3837:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R3838:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R3839:Hmgcr UTSW 13 96659089 missense probably benign 0.19
R4034:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4035:Hmgcr UTSW 13 96651063 missense probably damaging 1.00
R4210:Hmgcr UTSW 13 96660221 missense probably damaging 1.00
R4783:Hmgcr UTSW 13 96666193 missense probably damaging 1.00
R4820:Hmgcr UTSW 13 96660192 missense probably damaging 1.00
R5090:Hmgcr UTSW 13 96650590 missense probably benign
R5113:Hmgcr UTSW 13 96656732 missense probably benign 0.00
R5209:Hmgcr UTSW 13 96666512 splice site probably benign
R5354:Hmgcr UTSW 13 96654896 missense probably benign 0.26
R5571:Hmgcr UTSW 13 96666663 missense probably benign 0.11
R5804:Hmgcr UTSW 13 96666187 missense probably damaging 0.98
R5886:Hmgcr UTSW 13 96660183 missense probably damaging 1.00
R6340:Hmgcr UTSW 13 96665858 missense probably damaging 1.00
R6638:Hmgcr UTSW 13 96658982 missense probably benign
R6699:Hmgcr UTSW 13 96660209 missense probably damaging 1.00
R7024:Hmgcr UTSW 13 96658910 missense probably benign 0.10
R7061:Hmgcr UTSW 13 96666148 missense possibly damaging 0.64
R7284:Hmgcr UTSW 13 96652665 missense probably damaging 1.00
R7286:Hmgcr UTSW 13 96666597 missense probably damaging 1.00
R7705:Hmgcr UTSW 13 96656723 missense probably benign 0.01
R7709:Hmgcr UTSW 13 96663097 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGTCAGCACCCAGAGCTAG -3'
(R):5'- GCACTACTGAAAGAGTGTTGGGTTC -3'

Sequencing Primer
(F):5'- GTCAGCACCCAGAGCTAGCTAATAG -3'
(R):5'- CAGCAGTTAGTACTCTCAGATGAG -3'
Posted On2015-01-23