Incidental Mutation 'R3159:Gxylt1'
ID258076
Institutional Source Beutler Lab
Gene Symbol Gxylt1
Ensembl Gene ENSMUSG00000036197
Gene Nameglucoside xylosyltransferase 1
SynonymsGlt8d3, LOC382997, LOC223827
MMRRC Submission 040610-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3159 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location93239742-93275179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93245032 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 384 (I384T)
Ref Sequence ENSEMBL: ENSMUSP00000155854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049484] [ENSMUST00000057896] [ENSMUST00000230063]
Predicted Effect probably benign
Transcript: ENSMUST00000049484
SMART Domains Protein: ENSMUSP00000047281
Gene: ENSMUSG00000036197

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
Pfam:Glyco_transf_8 81 330 9.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057896
AA Change: I415T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000081947
Gene: ENSMUSG00000036197
AA Change: I415T

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
Pfam:Glyco_transf_8 103 359 4.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230063
AA Change: I384T

PolyPhen 2 Score 0.280 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0808 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GXYLT1 is a xylosyltransferase (EC 2.4.2.-) that adds the first xylose to O-glucose-modified residues in the epidermal growth factor (EGF; MIM 131530) repeats of proteins such as NOTCH1 (MIM 190198) (Sethi et al., 2010 [PubMed 19940119]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,415 V1931A probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cdk15 T C 1: 59,301,281 I313T probably damaging Het
Celsr3 T C 9: 108,827,710 V464A possibly damaging Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm5145 A G 17: 20,570,893 I178V probably benign Het
Hmgcr C T 13: 96,665,847 V110I probably damaging Het
Hsd17b2 A C 8: 117,758,752 D318A probably damaging Het
Ighv8-6 A G 12: 115,165,888 S83P probably damaging Het
Isg20 C A 7: 78,914,453 A36E possibly damaging Het
Jade3 A G X: 20,479,544 K54E probably damaging Het
Mark1 A T 1: 184,908,387 Y505N probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1086 A G 2: 86,676,511 I274T probably benign Het
Pcdha2 C T 18: 36,941,197 T627I probably damaging Het
Polg2 A C 11: 106,768,337 V450G probably benign Het
Rbm48 A T 5: 3,596,105 V33D possibly damaging Het
Rfx6 A T 10: 51,726,720 R778W probably damaging Het
Sav1 A T 12: 69,984,552 D65E probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Shank2 C A 7: 144,081,874 N328K probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Slit1 A G 19: 41,604,373 Y1214H probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Tgfb3 A T 12: 86,058,986 W332R probably damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav4-4-dv10 A T 14: 53,684,102 K86* probably null Het
Zfp667 T C 7: 6,306,000 C556R probably damaging Het
Zranb3 A G 1: 127,972,949 I713T probably benign Het
Other mutations in Gxylt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Gxylt1 APN 15 93254392 missense probably damaging 0.98
IGL03403:Gxylt1 APN 15 93261775 missense possibly damaging 0.71
PIT4260001:Gxylt1 UTSW 15 93261827 missense probably damaging 1.00
R0040:Gxylt1 UTSW 15 93254555 splice site probably benign
R0040:Gxylt1 UTSW 15 93254555 splice site probably benign
R1033:Gxylt1 UTSW 15 93245077 missense probably benign 0.00
R1413:Gxylt1 UTSW 15 93254392 missense probably damaging 0.98
R2132:Gxylt1 UTSW 15 93244970 makesense probably null
R2144:Gxylt1 UTSW 15 93254480 missense probably benign 0.31
R3157:Gxylt1 UTSW 15 93245032 missense probably benign 0.28
R5436:Gxylt1 UTSW 15 93247899 missense probably damaging 1.00
R5567:Gxylt1 UTSW 15 93254299 critical splice donor site probably null
R5570:Gxylt1 UTSW 15 93254299 critical splice donor site probably null
R5599:Gxylt1 UTSW 15 93254317 small deletion probably benign
R5656:Gxylt1 UTSW 15 93245661 missense probably damaging 1.00
R7650:Gxylt1 UTSW 15 93245658 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CCTGGAGCACAAGAGTTCAAC -3'
(R):5'- GTGTACTTCATGTGAGATAGCAAATGG -3'

Sequencing Primer
(F):5'- TGGAGCACAAGAGTTCAACTTACTC -3'
(R):5'- TCATGTGAGATAGCAAATGGTAGTTG -3'
Posted On2015-01-23