Incidental Mutation 'R3159:Gm5145'
ID258079
Institutional Source Beutler Lab
Gene Symbol Gm5145
Ensembl Gene ENSMUSG00000071273
Gene Namepredicted pseudogene 5145
Synonyms
MMRRC Submission 040610-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R3159 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20570362-20571198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20570893 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 178 (I178V)
Ref Sequence ENSEMBL: ENSMUSP00000093293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095633] [ENSMUST00000169559]
Predicted Effect probably benign
Transcript: ENSMUST00000095633
AA Change: I178V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093293
Gene: ENSMUSG00000071273
AA Change: I178V

DomainStartEndE-ValueType
RRM 17 84 5.29e-5 SMART
low complexity region 101 113 N/A INTRINSIC
low complexity region 119 130 N/A INTRINSIC
low complexity region 160 175 N/A INTRINSIC
low complexity region 179 199 N/A INTRINSIC
RRM 207 274 1.55e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169559
SMART Domains Protein: ENSMUSP00000129347
Gene: ENSMUSG00000091259

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 83 467 3.1e-33 PFAM
Pfam:NCD3G 510 563 5.2e-22 PFAM
Pfam:7tm_3 594 831 4.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 36,959,415 V1931A probably benign Het
Ccdc146 T C 5: 21,399,792 E16G unknown Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cdk15 T C 1: 59,301,281 I313T probably damaging Het
Celsr3 T C 9: 108,827,710 V464A possibly damaging Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
Dscam T C 16: 96,678,510 T1146A probably benign Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gxylt1 A G 15: 93,245,032 I384T probably benign Het
Hmgcr C T 13: 96,665,847 V110I probably damaging Het
Hsd17b2 A C 8: 117,758,752 D318A probably damaging Het
Ighv8-6 A G 12: 115,165,888 S83P probably damaging Het
Isg20 C A 7: 78,914,453 A36E possibly damaging Het
Jade3 A G X: 20,479,544 K54E probably damaging Het
Mark1 A T 1: 184,908,387 Y505N probably damaging Het
Mmp11 C T 10: 75,927,114 probably benign Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Ociad1 A T 5: 73,310,345 R155* probably null Het
Olfr1086 A G 2: 86,676,511 I274T probably benign Het
Pcdha2 C T 18: 36,941,197 T627I probably damaging Het
Polg2 A C 11: 106,768,337 V450G probably benign Het
Rbm48 A T 5: 3,596,105 V33D possibly damaging Het
Rfx6 A T 10: 51,726,720 R778W probably damaging Het
Sav1 A T 12: 69,984,552 D65E probably benign Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Shank2 C A 7: 144,081,874 N328K probably damaging Het
Slc8a3 C A 12: 81,314,992 R351L probably damaging Het
Slc9b1 G A 3: 135,371,845 G100E probably damaging Het
Slit1 A G 19: 41,604,373 Y1214H probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Tgfb3 A T 12: 86,058,986 W332R probably damaging Het
Tmem132a C T 19: 10,859,537 W680* probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trav4-4-dv10 A T 14: 53,684,102 K86* probably null Het
Zfp667 T C 7: 6,306,000 C556R probably damaging Het
Zranb3 A G 1: 127,972,949 I713T probably benign Het
Other mutations in Gm5145
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02350:Gm5145 APN 17 20570440 missense probably damaging 1.00
IGL02357:Gm5145 APN 17 20570440 missense probably damaging 1.00
IGL02587:Gm5145 APN 17 20571190 missense probably damaging 1.00
R3885:Gm5145 UTSW 17 20571010 missense probably benign 0.30
R4151:Gm5145 UTSW 17 20571098 missense probably damaging 1.00
R4583:Gm5145 UTSW 17 20570453 missense probably benign 0.02
R4798:Gm5145 UTSW 17 20570548 missense probably damaging 1.00
R7147:Gm5145 UTSW 17 20571061 missense probably damaging 1.00
R7297:Gm5145 UTSW 17 20570731 missense probably benign 0.00
R7627:Gm5145 UTSW 17 20570392 nonsense probably null
R7670:Gm5145 UTSW 17 20570384 missense probably benign 0.09
R7897:Gm5145 UTSW 17 20570705 missense probably benign
R7901:Gm5145 UTSW 17 20570638 missense possibly damaging 0.86
R7980:Gm5145 UTSW 17 20570705 missense probably benign
R7984:Gm5145 UTSW 17 20570638 missense possibly damaging 0.86
Z1177:Gm5145 UTSW 17 20571052 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGGACATCATTGCCAAG -3'
(R):5'- AAGGCGATGTCATGGCGTAC -3'

Sequencing Primer
(F):5'- CTCGGACATCATTGCCAAGATGAAG -3'
(R):5'- GTACCAGACGCACCTCCTTG -3'
Posted On2015-01-23