Incidental Mutation 'R0325:Lama3'
ID25808
Institutional Source Beutler Lab
Gene Symbol Lama3
Ensembl Gene ENSMUSG00000024421
Gene Namelaminin, alpha 3
Synonyms[a]3B, nicein, 150kDa
MMRRC Submission 038535-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0325 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location12333819-12583013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 12482126 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1369 (D1369A)
Ref Sequence ENSEMBL: ENSMUSP00000089703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092070]
Predicted Effect probably damaging
Transcript: ENSMUST00000092070
AA Change: D1369A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089703
Gene: ENSMUSG00000024421
AA Change: D1369A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
LamNT 38 294 1.46e-153 SMART
EGF_Lam 296 350 1.39e-4 SMART
EGF_Lam 353 420 2.66e-10 SMART
EGF_Lam 423 464 3.51e-10 SMART
EGF_Lam 488 530 1.73e-9 SMART
EGF_Lam 533 576 3.81e-11 SMART
EGF_like 579 625 1.82e-1 SMART
EGF_Lam 628 678 5.15e-8 SMART
EGF_Lam 681 725 3.54e-6 SMART
low complexity region 768 781 N/A INTRINSIC
EGF_Lam 1263 1306 3.15e-12 SMART
EGF_Lam 1309 1350 6.3e-3 SMART
EGF_Lam 1353 1399 1.49e-13 SMART
EGF_Lam 1402 1450 8.18e-11 SMART
LamB 1509 1638 4.34e-55 SMART
Pfam:Laminin_EGF 1647 1681 7.9e-5 PFAM
EGF_Lam 1684 1728 2.66e-10 SMART
EGF_Lam 1731 1781 7.81e-8 SMART
Pfam:Laminin_I 1836 2102 2.7e-93 PFAM
low complexity region 2185 2200 N/A INTRINSIC
coiled coil region 2211 2238 N/A INTRINSIC
LamG 2406 2566 1.67e-2 SMART
LamG 2614 2742 1.72e-17 SMART
LamG 2785 2900 3.96e-17 SMART
LamG 3005 3133 1.12e-34 SMART
LamG 3175 3308 3.41e-30 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the laminin family of secreted molecules. Laminins are heterotrimeric molecules that consist of alpha, beta, and gamma subunits that assemble through a coiled-coil domain. Laminins are essential for formation and function of the basement membrane and have additional functions in regulating cell migration and mechanical signal transduction. This gene encodes an alpha subunit and is responsive to several epithelial-mesenchymal regulators including keratinocyte growth factor, epidermal growth factor and insulin-like growth factor. Mutations in this gene have been identified as the cause of Herlitz type junctional epidermolysis bullosa and laryngoonychocutaneous syndrome. Alternative splicing and alternative promoter usage result in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation develop a lethal blistering phenotype similar to human junctional epidermolysis bullosa, and die 2-3 days after birth from a failure to thrive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik G T 1: 26,685,266 Q278K possibly damaging Het
4933416C03Rik T C 10: 116,113,569 I17M probably damaging Het
5330417C22Rik A G 3: 108,461,251 L808P probably damaging Het
Adcyap1 A G 17: 93,202,832 D96G probably benign Het
Adgrv1 C T 13: 81,540,015 V1749M probably damaging Het
Adnp2 A T 18: 80,130,653 N180K probably benign Het
Ahdc1 G T 4: 133,062,719 A424S unknown Het
Alpk3 G A 7: 81,067,953 R86H possibly damaging Het
Atf7ip A C 6: 136,560,989 T49P possibly damaging Het
Atp7b G A 8: 22,028,451 L124F probably benign Het
Bub1 A T 2: 127,801,394 L1010* probably null Het
Cd300c C A 11: 114,959,585 E131* probably null Het
Cep135 A G 5: 76,615,743 K527E probably damaging Het
Cfd G T 10: 79,891,758 E89* probably null Het
Crb1 A C 1: 139,241,166 C871W probably damaging Het
D6Ertd527e A T 6: 87,111,295 S147C unknown Het
Ddx60 A T 8: 61,983,855 E946D probably benign Het
Dmrt1 G A 19: 25,546,007 E241K probably benign Het
Dnah11 C G 12: 118,012,339 V2782L probably benign Het
Dzip1 T C 14: 118,909,557 I313M probably damaging Het
Egln3 T C 12: 54,203,512 E17G probably benign Het
Eif3d A G 15: 77,968,220 V42A probably damaging Het
Eogt C A 6: 97,113,955 G408W probably damaging Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Fmn2 T A 1: 174,609,954 probably null Het
Fndc3b T C 3: 27,467,430 E532G probably damaging Het
Gabrb3 T C 7: 57,765,530 L116P probably damaging Het
Galnt6 A T 15: 100,693,471 probably null Het
Glmp G A 3: 88,325,084 M1I probably null Het
Gm13101 A T 4: 143,966,740 V56E probably damaging Het
Gm13124 T C 4: 144,555,511 Y237C probably damaging Het
Gm5478 T C 15: 101,644,326 D79G probably damaging Het
Gnb1 T G 4: 155,551,683 D153E probably benign Het
Grik2 T C 10: 49,240,725 I86V probably damaging Het
Hdac3 C T 18: 37,940,952 probably null Het
Hdgfl2 G A 17: 56,099,181 R523H possibly damaging Het
Ifngr1 T A 10: 19,597,432 N43K probably damaging Het
Iqgap1 A G 7: 80,751,930 W476R probably benign Het
Jag1 A G 2: 137,095,445 probably null Het
Kars T C 8: 112,008,216 D46G probably benign Het
Kcnd2 A G 6: 21,216,683 I129V probably damaging Het
Lars A T 18: 42,250,902 V76E possibly damaging Het
Lgals9 T C 11: 78,963,448 I337V probably damaging Het
Lrp1b T C 2: 40,851,711 D3068G probably damaging Het
Med12l A G 3: 59,077,059 T462A possibly damaging Het
Megf9 T A 4: 70,455,941 D286V probably damaging Het
Meox1 T A 11: 101,879,401 S167C probably damaging Het
Mier2 C T 10: 79,542,596 probably null Het
Mrps2 C A 2: 28,469,779 T216K probably damaging Het
Mto1 A T 9: 78,453,004 D258V probably damaging Het
Mug1 A T 6: 121,849,842 H208L probably benign Het
Myo15b T A 11: 115,884,265 I751N probably damaging Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ndrg4 T A 8: 95,710,935 M17K probably damaging Het
Nfrkb T G 9: 31,414,180 M973R probably benign Het
Nxph4 C T 10: 127,526,911 R37H probably damaging Het
Oas1e A G 5: 120,795,395 I35T probably damaging Het
Oc90 C T 15: 65,897,665 probably null Het
Olfr1045 G A 2: 86,198,711 L14F possibly damaging Het
Olfr1076 A T 2: 86,509,205 T249S probably benign Het
Olfr1271 A T 2: 90,265,536 M298K probably null Het
Olfr461 A T 6: 40,544,123 N285K possibly damaging Het
Olfr653 A T 7: 104,580,360 D238V probably damaging Het
Papola T A 12: 105,807,193 I157N probably damaging Het
Pcyox1l G C 18: 61,697,893 P303A possibly damaging Het
Pkdrej T C 15: 85,819,551 N728S probably benign Het
Pkp4 A G 2: 59,318,529 D542G probably damaging Het
Pla2g5 C T 4: 138,800,656 D100N probably benign Het
Poln C T 5: 34,149,764 R31H probably benign Het
Ppp3ca G A 3: 136,935,139 A484T probably benign Het
Prag1 A G 8: 36,103,804 T514A probably benign Het
Prex2 G A 1: 11,200,057 probably null Het
Prrc2b G T 2: 32,199,091 W403L probably damaging Het
Pter A T 2: 13,000,937 K307M probably damaging Het
Ptpn5 G A 7: 47,090,758 S99L probably benign Het
Ptpn5 A C 7: 47,090,759 S99A probably benign Het
Rpap1 A C 2: 119,771,840 H674Q probably benign Het
Rph3a A T 5: 120,943,064 D623E probably benign Het
Sdr9c7 G T 10: 127,898,719 E25D probably benign Het
Sept9 T G 11: 117,356,632 V479G probably damaging Het
Sgo2a A G 1: 58,016,697 D680G probably benign Het
Sgo2b A T 8: 63,928,376 I474N probably benign Het
Sgsm1 A T 5: 113,288,835 I43N probably damaging Het
Shprh G A 10: 11,170,109 M891I probably benign Het
Skiv2l A T 17: 34,844,815 Y551N possibly damaging Het
Slc12a9 A G 5: 137,322,846 M469T probably damaging Het
Slc4a2 A T 5: 24,435,943 I747F probably damaging Het
Slc7a6 T A 8: 106,194,517 N373K probably damaging Het
Slc7a6os T C 8: 106,201,056 D296G probably benign Het
Sncaip A G 18: 52,905,809 T120A probably damaging Het
Sorcs1 G C 19: 50,313,042 probably null Het
Spata16 A G 3: 26,667,456 E42G probably damaging Het
Syne2 A T 12: 75,962,641 M2440L probably benign Het
Tead2 A G 7: 45,225,755 E232G probably damaging Het
Tmf1 T G 6: 97,176,504 T203P possibly damaging Het
Trrap C A 5: 144,816,395 H1843Q probably benign Het
Unc79 C A 12: 103,171,644 Q2314K probably damaging Het
Unc80 G T 1: 66,510,881 G766V probably damaging Het
Vmn1r217 A G 13: 23,114,594 L46P probably damaging Het
Vmn2r80 A T 10: 79,148,939 I42F possibly damaging Het
Vwa5a T C 9: 38,728,665 V403A probably damaging Het
Zfp42 T C 8: 43,295,951 E171G probably damaging Het
Zfp64 A T 2: 168,926,040 S551T probably benign Het
Other mutations in Lama3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Lama3 APN 18 12580292 missense probably benign
IGL00272:Lama3 APN 18 12491548 missense probably damaging 1.00
IGL00335:Lama3 APN 18 12449588 splice site probably benign
IGL00836:Lama3 APN 18 12472228 missense probably benign 0.01
IGL01017:Lama3 APN 18 12441143 critical splice donor site probably null
IGL01025:Lama3 APN 18 12481037 missense probably benign 0.09
IGL01394:Lama3 APN 18 12531926 missense probably null 0.39
IGL01545:Lama3 APN 18 12441131 missense probably benign 0.01
IGL01685:Lama3 APN 18 12453880 splice site probably benign
IGL01863:Lama3 APN 18 12419936 splice site probably benign
IGL01869:Lama3 APN 18 12524763 missense possibly damaging 0.94
IGL01894:Lama3 APN 18 12572064 missense probably benign 0.09
IGL02027:Lama3 APN 18 12516513 missense probably damaging 1.00
IGL02106:Lama3 APN 18 12468314 missense probably damaging 0.98
IGL02307:Lama3 APN 18 12581783 missense probably benign 0.09
IGL02342:Lama3 APN 18 12491476 missense probably damaging 1.00
IGL02377:Lama3 APN 18 12556750 missense possibly damaging 0.49
IGL02401:Lama3 APN 18 12557727 missense probably benign 0.02
IGL02517:Lama3 APN 18 12537858 critical splice donor site probably null
IGL02644:Lama3 APN 18 12525853 missense probably benign 0.12
IGL02733:Lama3 APN 18 12578127 missense probably damaging 0.99
IGL02932:Lama3 APN 18 12528801 missense probably damaging 1.00
IGL03006:Lama3 APN 18 12468368 splice site probably benign
IGL03038:Lama3 APN 18 12419250 missense probably damaging 0.99
IGL03064:Lama3 APN 18 12439349 missense possibly damaging 0.72
IGL03146:Lama3 APN 18 12527624 missense possibly damaging 0.66
IGL03233:Lama3 APN 18 12481038 missense probably damaging 1.00
IGL03255:Lama3 APN 18 12539703 missense probably damaging 1.00
IGL03369:Lama3 APN 18 12553283 missense probably benign 0.05
IGL03412:Lama3 APN 18 12419182 missense probably damaging 0.99
IGL02980:Lama3 UTSW 18 12553231 missense probably benign 0.01
IGL03014:Lama3 UTSW 18 12539967 missense possibly damaging 0.95
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0007:Lama3 UTSW 18 12497881 splice site probably benign
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0050:Lama3 UTSW 18 12404103 missense probably damaging 1.00
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0063:Lama3 UTSW 18 12528705 splice site probably benign
R0106:Lama3 UTSW 18 12403982 missense probably damaging 0.96
R0148:Lama3 UTSW 18 12448272 missense probably damaging 1.00
R0165:Lama3 UTSW 18 12524810 missense probably damaging 0.99
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0240:Lama3 UTSW 18 12539823 splice site probably null
R0316:Lama3 UTSW 18 12519877 missense probably benign 0.09
R0365:Lama3 UTSW 18 12507007 missense probably damaging 0.96
R0390:Lama3 UTSW 18 12407563 missense probably benign 0.10
R0408:Lama3 UTSW 18 12456837 missense probably benign
R0449:Lama3 UTSW 18 12500512 unclassified probably null
R0453:Lama3 UTSW 18 12465478 missense possibly damaging 0.63
R0480:Lama3 UTSW 18 12450424 missense possibly damaging 0.81
R0536:Lama3 UTSW 18 12525894 missense probably damaging 1.00
R0545:Lama3 UTSW 18 12561701 missense possibly damaging 0.90
R0567:Lama3 UTSW 18 12549252 missense probably benign
R0605:Lama3 UTSW 18 12506949 missense probably benign 0.02
R0617:Lama3 UTSW 18 12419258 critical splice donor site probably null
R0629:Lama3 UTSW 18 12419245 missense possibly damaging 0.79
R0671:Lama3 UTSW 18 12477590 missense possibly damaging 0.80
R0730:Lama3 UTSW 18 12456850 splice site probably benign
R1216:Lama3 UTSW 18 12421134 splice site probably benign
R1356:Lama3 UTSW 18 12500577 unclassified probably benign
R1386:Lama3 UTSW 18 12477370 missense probably benign 0.04
R1424:Lama3 UTSW 18 12519991 missense probably benign 0.13
R1426:Lama3 UTSW 18 12481098 critical splice donor site probably null
R1437:Lama3 UTSW 18 12549227 missense possibly damaging 0.46
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1468:Lama3 UTSW 18 12441107 missense probably benign 0.00
R1472:Lama3 UTSW 18 12482045 missense probably benign 0.23
R1557:Lama3 UTSW 18 12513731 splice site probably benign
R1571:Lama3 UTSW 18 12539717 missense probably damaging 0.98
R1599:Lama3 UTSW 18 12450400 nonsense probably null
R1631:Lama3 UTSW 18 12407494 missense probably damaging 1.00
R1647:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1648:Lama3 UTSW 18 12532199 missense possibly damaging 0.90
R1719:Lama3 UTSW 18 12479872 critical splice donor site probably null
R1757:Lama3 UTSW 18 12465499 missense probably benign 0.10
R1766:Lama3 UTSW 18 12402062 missense probably damaging 1.00
R1853:Lama3 UTSW 18 12513705 missense possibly damaging 0.75
R1856:Lama3 UTSW 18 12537781 nonsense probably null
R1909:Lama3 UTSW 18 12581798 missense probably benign 0.19
R1913:Lama3 UTSW 18 12495279 missense probably benign 0.15
R1975:Lama3 UTSW 18 12453863 missense probably damaging 1.00
R2014:Lama3 UTSW 18 12524721 splice site probably benign
R2059:Lama3 UTSW 18 12528333 missense probably damaging 0.98
R2060:Lama3 UTSW 18 12528726 missense probably benign 0.30
R2086:Lama3 UTSW 18 12524830 missense probably benign 0.39
R2115:Lama3 UTSW 18 12402849 missense possibly damaging 0.94
R2291:Lama3 UTSW 18 12525079 missense probably damaging 0.98
R2860:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2861:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R2862:Lama3 UTSW 18 12453750 missense probably damaging 1.00
R3410:Lama3 UTSW 18 12413858 critical splice donor site probably null
R3614:Lama3 UTSW 18 12448288 missense probably benign 0.03
R3696:Lama3 UTSW 18 12439475 splice site probably benign
R3752:Lama3 UTSW 18 12507029 missense probably damaging 1.00
R3967:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3968:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3969:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R3970:Lama3 UTSW 18 12580341 missense probably damaging 1.00
R4088:Lama3 UTSW 18 12504308 nonsense probably null
R4118:Lama3 UTSW 18 12450431 missense probably benign 0.01
R4222:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4223:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4224:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4225:Lama3 UTSW 18 12450403 missense probably damaging 1.00
R4367:Lama3 UTSW 18 12513690 missense probably damaging 1.00
R4404:Lama3 UTSW 18 12582531 missense probably benign 0.01
R4424:Lama3 UTSW 18 12519872 nonsense probably null
R4483:Lama3 UTSW 18 12549253 missense probably benign 0.32
R4484:Lama3 UTSW 18 12481088 missense probably benign
R4516:Lama3 UTSW 18 12495358 missense probably damaging 1.00
R4556:Lama3 UTSW 18 12479759 missense possibly damaging 0.63
R4616:Lama3 UTSW 18 12504397 critical splice donor site probably null
R4702:Lama3 UTSW 18 12578029 nonsense probably null
R4704:Lama3 UTSW 18 12553223 missense probably benign 0.08
R4750:Lama3 UTSW 18 12504359 missense probably benign 0.25
R4753:Lama3 UTSW 18 12482084 missense probably damaging 1.00
R4767:Lama3 UTSW 18 12500563 missense probably benign 0.32
R4777:Lama3 UTSW 18 12413771 missense probably damaging 1.00
R4782:Lama3 UTSW 18 12411570 nonsense probably null
R4784:Lama3 UTSW 18 12449544 missense probably benign 0.20
R4816:Lama3 UTSW 18 12477604 missense possibly damaging 0.93
R4833:Lama3 UTSW 18 12441131 missense probably benign 0.01
R4854:Lama3 UTSW 18 12411542 missense probably benign 0.00
R4863:Lama3 UTSW 18 12498678 intron probably benign
R4863:Lama3 UTSW 18 12539793 missense probably damaging 0.99
R4953:Lama3 UTSW 18 12448305 missense probably damaging 1.00
R4974:Lama3 UTSW 18 12552826 missense probably damaging 0.98
R4996:Lama3 UTSW 18 12518743 missense probably benign 0.24
R5049:Lama3 UTSW 18 12582611 missense probably benign 0.19
R5057:Lama3 UTSW 18 12531948 missense probably null 0.82
R5090:Lama3 UTSW 18 12542402 missense possibly damaging 0.94
R5122:Lama3 UTSW 18 12539766 missense possibly damaging 0.53
R5215:Lama3 UTSW 18 12577900 missense probably damaging 1.00
R5245:Lama3 UTSW 18 12419893 missense probably damaging 1.00
R5259:Lama3 UTSW 18 12465508 missense probably damaging 1.00
R5320:Lama3 UTSW 18 12552855 missense probably damaging 0.99
R5377:Lama3 UTSW 18 12453746 missense probably damaging 0.99
R5432:Lama3 UTSW 18 12572066 missense probably damaging 1.00
R5500:Lama3 UTSW 18 12456764 missense possibly damaging 0.93
R5534:Lama3 UTSW 18 12553210 missense probably benign 0.00
R5589:Lama3 UTSW 18 12472220 missense possibly damaging 0.46
R5604:Lama3 UTSW 18 12439348 missense probably benign
R5617:Lama3 UTSW 18 12498936 intron probably benign
R5709:Lama3 UTSW 18 12539799 missense probably damaging 1.00
R5965:Lama3 UTSW 18 12429887 missense possibly damaging 0.67
R6042:Lama3 UTSW 18 12574254 missense probably damaging 1.00
R6065:Lama3 UTSW 18 12469928 missense possibly damaging 0.53
R6085:Lama3 UTSW 18 12482099 missense probably benign 0.01
R6212:Lama3 UTSW 18 12513645 missense probably damaging 1.00
R6268:Lama3 UTSW 18 12524737 missense probably damaging 0.98
R6276:Lama3 UTSW 18 12506949 missense probably benign 0.02
R6366:Lama3 UTSW 18 12482137 missense probably damaging 1.00
R6393:Lama3 UTSW 18 12479756 missense probably benign 0.44
R6493:Lama3 UTSW 18 12482148 critical splice donor site probably null
R6505:Lama3 UTSW 18 12495348 missense probably benign 0.02
R6563:Lama3 UTSW 18 12537766 missense probably damaging 1.00
R6582:Lama3 UTSW 18 12577840 missense probably damaging 1.00
R6585:Lama3 UTSW 18 12419257 critical splice donor site probably null
R6609:Lama3 UTSW 18 12513678 missense probably damaging 0.99
R6656:Lama3 UTSW 18 12549226 missense possibly damaging 0.66
R6833:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R6834:Lama3 UTSW 18 12491548 missense probably damaging 1.00
R7019:Lama3 UTSW 18 12528418 missense probably damaging 0.97
R7026:Lama3 UTSW 18 12516548 missense probably damaging 0.98
R7088:Lama3 UTSW 18 12582545 missense possibly damaging 0.90
R7100:Lama3 UTSW 18 12582644 missense possibly damaging 0.80
R7102:Lama3 UTSW 18 12552813 missense possibly damaging 0.66
R7103:Lama3 UTSW 18 12531879 missense probably benign 0.00
R7121:Lama3 UTSW 18 12462782 missense probably benign 0.06
R7133:Lama3 UTSW 18 12539786 missense probably benign 0.05
R7150:Lama3 UTSW 18 12468289 missense probably damaging 1.00
R7158:Lama3 UTSW 18 12456812 missense probably benign 0.20
R7170:Lama3 UTSW 18 12404076 missense probably benign 0.26
R7216:Lama3 UTSW 18 12430000 missense probably damaging 1.00
R7223:Lama3 UTSW 18 12582608 missense possibly damaging 0.53
R7243:Lama3 UTSW 18 12419845 missense probably damaging 1.00
R7282:Lama3 UTSW 18 12439392 missense probably damaging 0.99
R7337:Lama3 UTSW 18 12507040 splice site probably null
R7442:Lama3 UTSW 18 12472181 critical splice acceptor site probably null
R7487:Lama3 UTSW 18 12419237 missense probably benign
R7604:Lama3 UTSW 18 12500493 missense possibly damaging 0.93
R7609:Lama3 UTSW 18 12531834 critical splice acceptor site probably null
R7650:Lama3 UTSW 18 12537838 missense probably benign 0.01
X0019:Lama3 UTSW 18 12582574 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGGGCTGCTTCAGAATGTCTTGAAC -3'
(R):5'- ACCTGCCCAGCAAAATCTCTTCTTG -3'

Sequencing Primer
(F):5'- TGCTATGAGCAGTTCAGATCACC -3'
(R):5'- CAAAATCTCTTCTTGCTGGGAAGC -3'
Posted On2013-04-16