Incidental Mutation 'R3160:Urb1'
ID 258126
Institutional Source Beutler Lab
Gene Symbol Urb1
Ensembl Gene ENSMUSG00000039929
Gene Name URB1 ribosome biogenesis 1 homolog (S. cerevisiae)
Synonyms 4921511H13Rik, 5730405K23Rik
MMRRC Submission 040611-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3160 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 90751527-90810413 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90797903 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 247 (L247P)
Ref Sequence ENSEMBL: ENSMUSP00000114717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000140920]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000140920
AA Change: L247P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: L247P

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:Npa1 78 396 1.5e-86 PFAM
low complexity region 751 761 N/A INTRINSIC
low complexity region 955 966 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1360 1375 N/A INTRINSIC
Pfam:NopRA1 1670 1859 3.6e-60 PFAM
low complexity region 2029 2040 N/A INTRINSIC
low complexity region 2092 2111 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142955
Meta Mutation Damage Score 0.7568 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A G 6: 40,926,069 M123T probably benign Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Btnl2 T C 17: 34,358,065 W65R probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Ccdc181 T A 1: 164,280,296 S183T probably damaging Het
Cep350 T C 1: 155,863,164 H2311R probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crbn T C 6: 106,790,866 Q221R probably benign Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Decr1 T A 4: 15,930,972 D120V probably damaging Het
Dennd1c C T 17: 57,066,562 G637D possibly damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dnajc13 G T 9: 104,219,898 N510K possibly damaging Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Iqgap1 G A 7: 80,752,338 A393V probably benign Het
Irak2 G T 6: 113,672,760 A119S probably benign Het
Itgb2l A G 16: 96,437,389 L70P probably damaging Het
Itsn1 C A 16: 91,853,044 S202* probably null Het
Mill2 A C 7: 18,856,174 E127A probably benign Het
Msh6 T C 17: 87,985,481 Y555H probably damaging Het
Myo18b A C 5: 112,692,728 S2400A probably damaging Het
Naa25 A G 5: 121,435,072 probably null Het
Nop2 A G 6: 125,134,592 N96S probably benign Het
Olfr1263 T G 2: 90,015,021 Y30* probably null Het
Olfr156 T A 4: 43,820,544 K272N probably benign Het
Olfr30 T C 11: 58,455,227 T241A probably damaging Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Pde5a T A 3: 122,781,628 L356* probably null Het
Ralgapa1 A T 12: 55,709,586 N1075K probably damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Serinc2 A G 4: 130,260,735 S175P probably benign Het
Socs5 A T 17: 87,134,718 Q362L probably damaging Het
Srbd1 A T 17: 86,130,215 D233E probably benign Het
Srgap3 A G 6: 112,729,658 V826A probably benign Het
Tns2 A G 15: 102,113,336 E1118G possibly damaging Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Tuba8 A G 6: 121,222,738 D127G possibly damaging Het
Tulp4 A G 17: 6,198,708 M1V probably null Het
Usp32 A G 11: 85,025,536 W861R probably damaging Het
Vmn1r48 G A 6: 90,036,378 T155I probably benign Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Other mutations in Urb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Urb1 APN 16 90753321 critical splice donor site probably null
IGL00915:Urb1 APN 16 90779098 missense possibly damaging 0.76
IGL01108:Urb1 APN 16 90792814 missense probably damaging 1.00
IGL01122:Urb1 APN 16 90804458 missense possibly damaging 0.81
IGL01387:Urb1 APN 16 90757761 missense possibly damaging 0.64
IGL01484:Urb1 APN 16 90777560 missense probably benign 0.11
IGL01606:Urb1 APN 16 90760459 missense probably damaging 1.00
IGL01989:Urb1 APN 16 90769586 splice site probably benign
IGL02516:Urb1 APN 16 90772695 missense possibly damaging 0.49
IGL03018:Urb1 APN 16 90788156 missense probably benign 0.02
IGL03165:Urb1 APN 16 90780304 missense probably damaging 1.00
IGL03216:Urb1 APN 16 90788114 missense probably benign 0.00
H8562:Urb1 UTSW 16 90769469 missense probably benign 0.08
H8786:Urb1 UTSW 16 90769469 missense probably benign 0.08
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0064:Urb1 UTSW 16 90779140 missense probably benign
R0359:Urb1 UTSW 16 90791160 missense probably damaging 1.00
R0386:Urb1 UTSW 16 90796399 missense probably damaging 1.00
R0508:Urb1 UTSW 16 90783262 splice site probably benign
R0517:Urb1 UTSW 16 90777422 nonsense probably null
R0704:Urb1 UTSW 16 90776207 missense probably benign 0.31
R0755:Urb1 UTSW 16 90774094 missense probably damaging 1.00
R0755:Urb1 UTSW 16 90779138 missense probably benign
R0783:Urb1 UTSW 16 90810297 missense possibly damaging 0.55
R0833:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0836:Urb1 UTSW 16 90795448 missense possibly damaging 0.89
R0970:Urb1 UTSW 16 90769447 missense possibly damaging 0.83
R1144:Urb1 UTSW 16 90776318 splice site probably null
R1344:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1418:Urb1 UTSW 16 90769466 missense probably damaging 1.00
R1453:Urb1 UTSW 16 90796492 missense probably damaging 1.00
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1470:Urb1 UTSW 16 90752014 missense probably benign 0.34
R1520:Urb1 UTSW 16 90774745 missense probably benign 0.00
R1521:Urb1 UTSW 16 90753863 missense probably damaging 1.00
R1598:Urb1 UTSW 16 90777440 missense possibly damaging 0.93
R1617:Urb1 UTSW 16 90760452 missense possibly damaging 0.82
R1625:Urb1 UTSW 16 90774048 critical splice donor site probably null
R1640:Urb1 UTSW 16 90772626 missense probably benign 0.00
R1664:Urb1 UTSW 16 90788082 critical splice donor site probably null
R1672:Urb1 UTSW 16 90787397 missense probably damaging 1.00
R1694:Urb1 UTSW 16 90767040 missense probably benign
R1856:Urb1 UTSW 16 90761695 missense probably benign 0.00
R2001:Urb1 UTSW 16 90762344 missense probably benign 0.30
R2196:Urb1 UTSW 16 90774256 missense probably benign 0.01
R2850:Urb1 UTSW 16 90774256 missense probably benign 0.01
R3009:Urb1 UTSW 16 90774798 missense probably benign 0.09
R3104:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3105:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3106:Urb1 UTSW 16 90795443 missense probably damaging 1.00
R3162:Urb1 UTSW 16 90797903 missense probably damaging 1.00
R3900:Urb1 UTSW 16 90783376 missense possibly damaging 0.86
R4014:Urb1 UTSW 16 90769465 missense probably damaging 1.00
R4036:Urb1 UTSW 16 90788086 missense probably benign
R4332:Urb1 UTSW 16 90774537 missense probably damaging 1.00
R4448:Urb1 UTSW 16 90769394 missense possibly damaging 0.71
R4581:Urb1 UTSW 16 90788146 missense probably benign 0.04
R4593:Urb1 UTSW 16 90787444 missense probably damaging 1.00
R4610:Urb1 UTSW 16 90776271 missense probably benign 0.43
R4659:Urb1 UTSW 16 90776129 missense probably damaging 0.96
R4672:Urb1 UTSW 16 90772634 missense probably benign
R4681:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R4771:Urb1 UTSW 16 90753518 missense probably benign 0.00
R4790:Urb1 UTSW 16 90769555 nonsense probably null
R4798:Urb1 UTSW 16 90757827 missense probably benign 0.12
R4809:Urb1 UTSW 16 90759842 missense possibly damaging 0.82
R4850:Urb1 UTSW 16 90795414 nonsense probably null
R4916:Urb1 UTSW 16 90783328 missense probably damaging 1.00
R4969:Urb1 UTSW 16 90805411 missense probably damaging 1.00
R5032:Urb1 UTSW 16 90756171 missense probably benign 0.00
R5111:Urb1 UTSW 16 90752017 missense probably benign 0.00
R5122:Urb1 UTSW 16 90752095 nonsense probably null
R5184:Urb1 UTSW 16 90783274 critical splice donor site probably null
R5199:Urb1 UTSW 16 90792748 missense possibly damaging 0.95
R5436:Urb1 UTSW 16 90792762 missense probably damaging 1.00
R5767:Urb1 UTSW 16 90776163 missense probably benign 0.00
R5812:Urb1 UTSW 16 90804537 missense probably damaging 0.99
R5872:Urb1 UTSW 16 90772764 nonsense probably null
R6052:Urb1 UTSW 16 90762383 missense probably damaging 1.00
R6063:Urb1 UTSW 16 90789097 missense probably benign 0.02
R6065:Urb1 UTSW 16 90803332 missense probably benign 0.03
R6181:Urb1 UTSW 16 90779094 missense probably benign 0.00
R6268:Urb1 UTSW 16 90753919 missense probably benign 0.03
R6429:Urb1 UTSW 16 90762430 splice site probably null
R6572:Urb1 UTSW 16 90787414 missense probably benign 0.37
R6606:Urb1 UTSW 16 90810268 missense probably benign 0.00
R6730:Urb1 UTSW 16 90779083 missense possibly damaging 0.89
R6838:Urb1 UTSW 16 90782106 missense possibly damaging 0.93
R7237:Urb1 UTSW 16 90791166 missense probably damaging 1.00
R7238:Urb1 UTSW 16 90752115 missense possibly damaging 0.88
R7339:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7341:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7361:Urb1 UTSW 16 90774768 missense probably damaging 0.99
R7365:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7366:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7440:Urb1 UTSW 16 90787408 missense probably damaging 1.00
R7530:Urb1 UTSW 16 90761634 missense probably damaging 1.00
R7553:Urb1 UTSW 16 90792864 missense probably damaging 1.00
R7557:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7603:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7607:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7609:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7610:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7612:Urb1 UTSW 16 90797910 missense probably damaging 1.00
R7613:Urb1 UTSW 16 90772573 critical splice donor site probably benign
R7684:Urb1 UTSW 16 90786118 nonsense probably null
R8029:Urb1 UTSW 16 90779152 missense possibly damaging 0.67
R8324:Urb1 UTSW 16 90791190 missense probably damaging 1.00
R8680:Urb1 UTSW 16 90774625 missense probably benign 0.00
R8785:Urb1 UTSW 16 90803423 missense probably benign 0.07
R8914:Urb1 UTSW 16 90810234 missense probably damaging 1.00
R8959:Urb1 UTSW 16 90774117 missense probably benign 0.26
R9005:Urb1 UTSW 16 90753790 missense probably benign 0.01
R9126:Urb1 UTSW 16 90769402 missense possibly damaging 0.53
R9195:Urb1 UTSW 16 90792750 missense probably benign 0.03
R9276:Urb1 UTSW 16 90772575 splice site probably benign
R9534:Urb1 UTSW 16 90786208 missense possibly damaging 0.54
Z1177:Urb1 UTSW 16 90753883 missense probably benign 0.00
Z1177:Urb1 UTSW 16 90774862 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCAGCTGAGGTCATATGAC -3'
(R):5'- TGAAACTGTGAACCTGGCAC -3'

Sequencing Primer
(F):5'- CAGCTGAGGTCATATGACAGCTTTTC -3'
(R):5'- CAGAAATCAGGTGTGGCATTATTTG -3'
Posted On 2015-01-23