Incidental Mutation 'R3161:Aox2'
List |< first << previous [record 7 of 53] next >> last >|
ID258139
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Namealdehyde oxidase 2
SynonymsAox3l1
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58278326-58380259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58304438 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 427 (V427L)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114366
AA Change: V427L

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: V427L

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161126
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R7975:Aox2 UTSW 1 58309028 missense probably benign 0.02
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTGGTAGTCCTTCCTGTGGAAC -3'
(R):5'- TCATTGAGGCTCCCTTTAAGGC -3'

Sequencing Primer
(F):5'- TGTGGAACAGAAACTTTGGCATGC -3'
(R):5'- CCCTTTAAGGCACAGAGTTCATG -3'
Posted On2015-01-23