Incidental Mutation 'R0328:Bard1'
ID25814
Institutional Source Beutler Lab
Gene Symbol Bard1
Ensembl Gene ENSMUSG00000026196
Gene NameBRCA1 associated RING domain 1
SynonymsENSMUSG00000060893, ENSMUSG00000073653
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0328 (G1)
Quality Score218
Status Validated
Chromosome1
Chromosomal Location71027498-71103146 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 71046762 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 595 (V595I)
Ref Sequence ENSEMBL: ENSMUSP00000027393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027393]
Predicted Effect probably benign
Transcript: ENSMUST00000027393
AA Change: V595I

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027393
Gene: ENSMUSG00000026196
AA Change: V595I

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
RING 44 80 3.71e-2 SMART
low complexity region 225 232 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
ANK 415 444 3.46e-4 SMART
ANK 448 477 8.32e-7 SMART
ANK 481 510 1.55e-6 SMART
BRCT 553 631 3.56e-10 SMART
BRCT 657 758 2.35e-10 SMART
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions of this gene fail to develop past the egg cylinder stage. The phenotype is similar to that of mice with homozygous for disruptions in Brca1 or homozygous for disruptions in both Bard1 and Brca1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Bard1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Bard1 APN 1 71031426 missense probably benign 0.08
IGL02128:Bard1 APN 1 71075228 missense possibly damaging 0.66
IGL02249:Bard1 APN 1 71053669 missense probably damaging 1.00
IGL02552:Bard1 APN 1 71065656 splice site probably benign
IGL02661:Bard1 APN 1 71075310 missense probably damaging 1.00
IGL03087:Bard1 APN 1 71067130 missense probably damaging 1.00
PIT4651001:Bard1 UTSW 1 71074928 missense probably benign 0.00
R0096:Bard1 UTSW 1 71053730 splice site probably benign
R0838:Bard1 UTSW 1 71030653 missense probably damaging 1.00
R2007:Bard1 UTSW 1 71031403 missense probably benign 0.00
R2055:Bard1 UTSW 1 71074872 missense probably benign 0.00
R2110:Bard1 UTSW 1 71075391 nonsense probably null
R2237:Bard1 UTSW 1 71074976 missense probably damaging 1.00
R2416:Bard1 UTSW 1 71074652 missense probably benign
R3054:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3055:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3056:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3871:Bard1 UTSW 1 71074940 missense probably benign 0.05
R3905:Bard1 UTSW 1 71067180 missense possibly damaging 0.70
R4117:Bard1 UTSW 1 71046763 missense probably damaging 1.00
R4766:Bard1 UTSW 1 71075174 missense probably benign 0.01
R5230:Bard1 UTSW 1 71053611 critical splice donor site probably null
R5250:Bard1 UTSW 1 71074563 missense probably damaging 1.00
R5531:Bard1 UTSW 1 71046721 missense probably damaging 1.00
R5653:Bard1 UTSW 1 71031429 missense probably benign
R6008:Bard1 UTSW 1 71030750 missense possibly damaging 0.65
R7503:Bard1 UTSW 1 71030836 missense probably damaging 1.00
R7543:Bard1 UTSW 1 71075430 missense probably damaging 1.00
R7750:Bard1 UTSW 1 71066942 intron probably null
R8134:Bard1 UTSW 1 71067138 missense probably damaging 1.00
V8831:Bard1 UTSW 1 71088217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGTGACTAACTCCAAGGACAGG -3'
(R):5'- AGGTGCTCTACCCTCAACAGGAAC -3'

Sequencing Primer
(F):5'- TCCAAGGACAGGACTATACTAACTG -3'
(R):5'- caccagaagagggcatcag -3'
Posted On2013-04-16