Mutagenetix > Incidental Mutation

Incidental Mutation 'R3161:Disp1'

258144

Institutional Source

Beutler Lab

Gene Symbol

Disp1

Ensembl Gene

ENSMUSG00000030768

Gene Name

dispatched RND transporter family member 1

Synonyms

1190008H24Rik, DispA

MMRRC Submission

040612-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.921) question?

Stock #

R3161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

183086266-183221522 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 183087242 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1205 (K1205E)

Ref Sequence

ENSEMBL: ENSMUSP00000141747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]

AlphaFold

Q3TDN0

Predicted Effect

probably benign
Transcript: ENSMUST00000003035
AA Change: K1205E

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: K1205E

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	279	765	6.8e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	518	670	1.7e-15	PFAM
Pfam:Patched	916	1130	8e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171366
AA Change: K1205E

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: K1205E

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195372
AA Change: K1205E

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: K1205E

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Meta Mutation Damage Score

0.0619

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	C	5: 63,896,490		probably benign	Het
1700066M21Rik	T	A	1: 57,383,075	N203K	probably benign	Het
1700125H20Rik	A	G	11: 85,173,284	S84G	probably damaging	Het
Adcy9	A	G	16: 4,311,588	L715P	probably damaging	Het
Adgrl2	G	A	3: 148,817,551	L1354F	probably damaging	Het
Amer2	A	G	14: 60,378,551	D65G	probably damaging	Het
Aox2	G	T	1: 58,304,438	V427L	possibly damaging	Het
Atad2b	C	A	12: 4,939,689	N133K	possibly damaging	Het
Bptf	A	T	11: 107,074,476	D1182E	probably damaging	Het
Camk1g	T	C	1: 193,359,807	T45A	possibly damaging	Het
Caps2	C	A	10: 112,182,486	Y180*	probably null	Het
Cfap54	T	A	10: 93,045,278	K349N	probably damaging	Het
Ciz1	A	G	2: 32,370,063	D207G	probably benign	Het
Copa	T	A	1: 172,091,233	C127S	probably damaging	Het
Crabp2	A	T	3: 87,952,177	K45*	probably null	Het
Daam1	C	A	12: 71,947,098	T425K	unknown	Het
Dapk2	T	G	9: 66,254,611	V267G	probably damaging	Het
Dlg4	G	C	11: 70,017,225	R4T	probably damaging	Het
Fbf1	A	G	11: 116,148,220	I743T	probably damaging	Het
Fen1	A	G	19: 10,200,291	L263P	probably damaging	Het
G6pc2	A	G	2: 69,220,112	N27S	probably damaging	Het
Garnl3	A	T	2: 33,034,711	N246K	probably damaging	Het
Gm7337	A	C	5: 87,851,557		noncoding transcript	Het
Gpr152	A	G	19: 4,142,714	T85A	probably benign	Het
Hnrnpu	T	C	1: 178,331,125		probably benign	Het
Ighv1-81	C	G	12: 115,920,329	E101Q	probably benign	Het
Ipo9	T	C	1: 135,409,476	T174A	probably benign	Het
Myo9a	C	T	9: 59,832,315		probably benign	Het
Nup155	G	T	15: 8,148,383	R1083S	possibly damaging	Het
Olfr1351	C	A	10: 79,017,604	T94N	probably benign	Het
Olfr213	C	T	6: 116,540,846	A131V	probably damaging	Het
Olfr262	T	C	19: 12,241,496	H55R	probably benign	Het
Olfr739	T	A	14: 50,425,031	C171S	probably damaging	Het
Phyh	T	A	2: 4,937,671		probably benign	Het
Pkp4	G	T	2: 59,308,105	R233M	probably damaging	Het
Plcb1	A	T	2: 135,335,482	Q578L	probably benign	Het
Ppil3	A	T	1: 58,434,414	N92K	probably benign	Het
Prokr1	C	T	6: 87,588,431	R144H	probably damaging	Het
Psap	T	C	10: 60,277,753	L4P	possibly damaging	Het
Rai14	T	C	15: 10,633,164	T47A	possibly damaging	Het
Rps2	G	T	17: 24,720,978	A129S	probably benign	Het
Sult2a4	T	C	7: 13,989,471	T40A	probably benign	Het
Tacr2	A	G	10: 62,265,245	D378G	probably benign	Het
Topaz1	T	C	9: 122,749,381	I452T	probably benign	Het
Ttn	A	G	2: 76,833,237		probably benign	Het
Vmn2r115	T	A	17: 23,357,024	M532K	possibly damaging	Het
Vmn2r117	A	G	17: 23,460,378	L624P	probably damaging	Het
Vstm5	T	G	9: 15,257,298	S53A	probably benign	Het
Wipf1	C	T	2: 73,434,949	E437K	probably damaging	Het
Wls	G	T	3: 159,897,436	C162F	probably damaging	Het
Yeats2	T	C	16: 20,193,645	V531A	probably damaging	Het
Zfp868	A	G	8: 69,612,085	S200P	probably benign	Het

Other mutations in Disp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB006:Disp1	UTSW	1	183135539	missense	probably benign
BB016:Disp1	UTSW	1	183135539	missense	probably benign
R1120:Disp1	UTSW	1	183098575	missense	probably benign	0.24
R1482:Disp1	UTSW	1	183086474	missense	possibly damaging	0.61
R1655:Disp1	UTSW	1	183087004	missense	probably benign	0.01
R1660:Disp1	UTSW	1	183087742	missense	probably damaging	1.00
R1816:Disp1	UTSW	1	183098575	missense	probably damaging	0.99
R1835:Disp1	UTSW	1	183089000	missense	probably damaging	1.00
R1954:Disp1	UTSW	1	183088543	missense	probably damaging	0.99
R2025:Disp1	UTSW	1	183088203	missense	probably damaging	1.00
R2136:Disp1	UTSW	1	183088378	missense	probably damaging	1.00
R2150:Disp1	UTSW	1	183088372	missense	probably damaging	1.00
R2207:Disp1	UTSW	1	183088342	missense	possibly damaging	0.94
R2392:Disp1	UTSW	1	183087167	missense	probably benign
R2831:Disp1	UTSW	1	183089319	small deletion	probably benign
R3111:Disp1	UTSW	1	183087523	missense	probably damaging	1.00
R3116:Disp1	UTSW	1	183088922	missense	probably benign	0.01
R3160:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3162:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3162:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3716:Disp1	UTSW	1	183087751	missense	probably damaging	1.00
R3914:Disp1	UTSW	1	183089102	missense	probably benign	0.05
R4061:Disp1	UTSW	1	183087700	missense	probably damaging	0.96
R4191:Disp1	UTSW	1	183089173	missense	probably damaging	1.00
R4261:Disp1	UTSW	1	183089386	missense	probably damaging	1.00
R4272:Disp1	UTSW	1	183087644	missense	possibly damaging	0.95
R4273:Disp1	UTSW	1	183087644	missense	possibly damaging	0.95
R4351:Disp1	UTSW	1	183099978	missense	probably benign	0.01
R4672:Disp1	UTSW	1	183098651	critical splice acceptor site	probably null
R4764:Disp1	UTSW	1	183088096	missense	probably damaging	1.00
R4910:Disp1	UTSW	1	183135463	missense	probably damaging	1.00
R5150:Disp1	UTSW	1	183089499	missense	probably damaging	0.98
R5502:Disp1	UTSW	1	183087886	missense	probably damaging	1.00
R5616:Disp1	UTSW	1	183088349	missense	probably benign	0.30
R5699:Disp1	UTSW	1	183088555	nonsense	probably null
R5813:Disp1	UTSW	1	183088410	missense	probably damaging	1.00
R5820:Disp1	UTSW	1	183135587	missense	probably benign	0.00
R6184:Disp1	UTSW	1	183086332	missense	probably benign	0.00
R6228:Disp1	UTSW	1	183099025	missense	possibly damaging	0.59
R6306:Disp1	UTSW	1	183087148	missense	possibly damaging	0.93
R6505:Disp1	UTSW	1	183086512	missense	probably benign	0.02
R6925:Disp1	UTSW	1	183086478	missense	probably benign
R7016:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7045:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7046:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7047:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7114:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7123:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7124:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7125:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7161:Disp1	UTSW	1	183087625	missense	possibly damaging	0.84
R7510:Disp1	UTSW	1	183088411	missense	probably damaging	1.00
R7756:Disp1	UTSW	1	183089734	missense	probably damaging	1.00
R7800:Disp1	UTSW	1	183098986	missense	probably benign	0.00
R7929:Disp1	UTSW	1	183135539	missense	probably benign
R8029:Disp1	UTSW	1	183089288	missense	probably damaging	1.00
R8036:Disp1	UTSW	1	183089239	missense	probably damaging	1.00
R8045:Disp1	UTSW	1	183089230	missense	probably damaging	1.00
R8054:Disp1	UTSW	1	183088248	nonsense	probably null
R8061:Disp1	UTSW	1	183087587	missense	probably damaging	1.00
R8094:Disp1	UTSW	1	183087628	missense	probably damaging	1.00
R8130:Disp1	UTSW	1	183135635	missense	probably benign	0.13
R8731:Disp1	UTSW	1	183087508	missense	possibly damaging	0.65
R9076:Disp1	UTSW	1	183087235	missense	possibly damaging	0.59
R9490:Disp1	UTSW	1	183089528	missense	probably benign	0.03
R9712:Disp1	UTSW	1	183135815	missense	probably damaging	0.99
R9745:Disp1	UTSW	1	183087746	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCTCGGCAGTTACATCTCGG -3'
(R):5'- CATGATGCTCGTCATGTGCG -3'

Sequencing Primer
(F):5'- CGGCAGTTACATCTCGGATTGAG -3'
(R):5'- TTTCCCTACAAAACTCCAGTGCAG -3'

Posted On

2015-01-23