Incidental Mutation 'R3161:Phyh'
ID258146
Institutional Source Beutler Lab
Gene Symbol Phyh
Ensembl Gene ENSMUSG00000026664
Gene Namephytanoyl-CoA hydroxylase
SynonymsLnap1
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location4919019-4938730 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 4937671 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027975]
Predicted Effect probably benign
Transcript: ENSMUST00000027975
SMART Domains Protein: ENSMUSP00000027975
Gene: ENSMUSG00000026664

DomainStartEndE-ValueType
Pfam:PhyH 61 277 1.4e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142299
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the PhyH family and encodes a peroxisomal protein that is involved in the alpha-oxidation of 3-methyl branched fatty acids. Specifically, this protein converts phytanoyl-CoA to 2-hydroxyphytanoyl-CoA. Mutations in this gene have been associated with Refsum disease (RD) and deficient protein activity has been associated with Zellweger syndrome and rhizomelic chondrodysplasia punctata. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: When fed a high phytol diet, mice homozygous for a null allele exhibit hepatic lipidosis and steatosis, ataxia, peripheral neuropathy and loss of spermatogonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Phyh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Phyh APN 2 4930793 missense probably null 1.00
R0552:Phyh UTSW 2 4936101 missense probably damaging 1.00
R1624:Phyh UTSW 2 4925683 missense probably benign 0.11
R1656:Phyh UTSW 2 4938353 missense probably damaging 0.97
R1721:Phyh UTSW 2 4937809 missense probably null 0.24
R5353:Phyh UTSW 2 4942201 unclassified probably benign
R5907:Phyh UTSW 2 4930651 intron probably null
R6093:Phyh UTSW 2 4919085 missense possibly damaging 0.51
R6188:Phyh UTSW 2 4927490 missense probably damaging 0.96
R6394:Phyh UTSW 2 4936003 missense probably benign 0.02
R7316:Phyh UTSW 2 4936044 nonsense probably null
X0060:Phyh UTSW 2 4938350 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGTCCTCTTGCGACATGC -3'
(R):5'- AGCGTTTCCTCTGTGATCG -3'

Sequencing Primer
(F):5'- TGCATACAAACACACACAAACATTG -3'
(R):5'- TGTGATCGCATGCAGTACC -3'
Posted On2015-01-23