Incidental Mutation 'R3161:Plcb1'
ID258153
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Namephospholipase C, beta 1
Synonyms3110043I21Rik
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location134786067-135475258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135335482 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 578 (Q578L)
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
Predicted Effect probably benign
Transcript: ENSMUST00000070724
AA Change: Q578L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: Q578L

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
AA Change: Q578L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: Q578L

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131552
AA Change: Q578L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: Q578L

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153402
Meta Mutation Damage Score 0.0878 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
BB001:Plcb1 UTSW 2 135359693 missense probably benign 0.00
BB011:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R4946:Plcb1 UTSW 2 135345095 missense probably benign 0.01
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7777:Plcb1 UTSW 2 135220757 missense possibly damaging 0.51
R7924:Plcb1 UTSW 2 135359693 missense probably benign 0.00
R8061:Plcb1 UTSW 2 135346396 missense probably benign
R8099:Plcb1 UTSW 2 135251734 missense possibly damaging 0.68
R8299:Plcb1 UTSW 2 135335476 missense probably damaging 1.00
R8394:Plcb1 UTSW 2 135317790 missense probably damaging 1.00
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCAAGACTCAACTTTTACTGC -3'
(R):5'- TCTCTATAGACCAGGCTACCAC -3'

Sequencing Primer
(F):5'- GCAGTTCCTACCTTCTAAGTC -3'
(R):5'- CACATTGTGACACCTGAGACTTGG -3'
Posted On2015-01-23