Mutagenetix > Incidental Mutations

Incidental Mutation 'R3161:Adgrl2'

258155

Institutional Source

Beutler Lab

Gene Symbol

Adgrl2

Ensembl Gene

ENSMUSG00000028184

Gene Name

adhesion G protein-coupled receptor L2

Synonyms

Lec1, Lphn2, Lphh1

MMRRC Submission

040612-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148815583-148990555 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 148817551 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 1354 (L1354F)

Ref Sequence

ENSEMBL: ENSMUSP00000142405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106128] [ENSMUST00000168352] [ENSMUST00000195988] [ENSMUST00000196526] [ENSMUST00000197567] [ENSMUST00000198779] [ENSMUST00000199059] [ENSMUST00000199238] [ENSMUST00000199750] [ENSMUST00000200543] [ENSMUST00000200154]

Predicted Effect

probably damaging
Transcript: ENSMUST00000106128
AA Change: L1363F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000101734
Gene: ENSMUSG00000028184
AA Change: L1363F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	2.5e-26	PFAM
OLF	142	398	5.22e-140	SMART
HormR	469	534	3.14e-20	SMART
Pfam:GAIN	537	764	1.3e-58	PFAM
GPS	788	840	3.47e-25	SMART
Pfam:7tm_2	848	1108	4.6e-69	PFAM
Pfam:Latrophilin	1128	1487	6.4e-181	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000168352
AA Change: L115F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132116
Gene: ENSMUSG00000028184
AA Change: L115F

Domain	Start	End	E-Value	Type
Pfam:Latrophilin	1	239	2.5e-122	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000195988
AA Change: L1311F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143444
Gene: ENSMUSG00000028184
AA Change: L1311F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.3e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.1e-66	PFAM
Pfam:Latrophilin	1119	1189	2.2e-28	PFAM
Pfam:Latrophilin	1184	1435	5.5e-123	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196526

SMART Domains

Protein: ENSMUSP00000143788
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	8.7e-24	PFAM
OLF	138	394	3.4e-142	SMART
HormR	465	530	2e-22	SMART
Pfam:GAIN	533	747	1.1e-54	PFAM
GPS	771	823	2.2e-27	SMART
Pfam:7tm_2	831	1067	6.5e-68	PFAM
Pfam:Latrophilin	1087	1158	9.9e-36	PFAM
low complexity region	1163	1173	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197348

Predicted Effect

probably damaging
Transcript: ENSMUST00000197567
AA Change: L1363F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000143626
Gene: ENSMUSG00000028184
AA Change: L1363F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	1.9e-26	PFAM
OLF	142	398	5.22e-140	SMART
HormR	469	534	3.14e-20	SMART
Pfam:GAIN	537	764	1.1e-58	PFAM
GPS	788	840	3.47e-25	SMART
Pfam:7tm_2	848	1108	6.4e-69	PFAM
Pfam:Latrophilin	1128	1487	2.8e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000197925

Predicted Effect

unknown
Transcript: ENSMUST00000198139
AA Change: L346F

Predicted Effect

probably damaging
Transcript: ENSMUST00000198779
AA Change: L1328F

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000142347
Gene: ENSMUSG00000028184
AA Change: L1328F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1084	1.8e-66	PFAM
Pfam:Latrophilin	1104	1452	7e-174	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199059
AA Change: L1343F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000143150
Gene: ENSMUSG00000028184
AA Change: L1343F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.3e-66	PFAM
Pfam:Latrophilin	1119	1467	7.1e-174	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000199238
AA Change: L1354F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142405
Gene: ENSMUSG00000028184
AA Change: L1354F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.4e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	469	534	2e-22	SMART
GPS	788	840	2.1e-27	SMART
Pfam:7tm_2	848	1099	8.4e-66	PFAM
Pfam:Latrophilin	1119	1478	1.6e-187	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199750
AA Change: L1217F

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000143320
Gene: ENSMUSG00000028184
AA Change: L1217F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.1e-23	PFAM
OLF	142	398	3.3e-142	SMART
HormR	403	468	1.9e-22	SMART
GPS	709	761	2.1e-27	SMART
Pfam:7tm_2	769	1005	1.6e-66	PFAM
Pfam:Latrophilin	1025	1095	2e-28	PFAM
Pfam:Latrophilin	1090	1341	4.9e-123	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000200543
AA Change: L1279F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000142336
Gene: ENSMUSG00000028184
AA Change: L1279F

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	3.2e-23	PFAM
OLF	138	394	3.3e-142	SMART
HormR	465	530	2e-22	SMART
GPS	771	823	2.1e-27	SMART
Pfam:7tm_2	831	1067	1.7e-66	PFAM
Pfam:Latrophilin	1087	1157	2.1e-28	PFAM
Pfam:Latrophilin	1152	1403	5.3e-123	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200023

Predicted Effect

probably benign
Transcript: ENSMUST00000200216

Predicted Effect

probably benign
Transcript: ENSMUST00000200456

Predicted Effect

probably benign
Transcript: ENSMUST00000200154

SMART Domains

Protein: ENSMUSP00000142865
Gene: ENSMUSG00000028184

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Gal_Lectin	49	129	2.5e-23	PFAM
OLF	138	394	3.3e-142	SMART
HormR	465	530	2e-22	SMART
GPS	771	823	2.1e-27	SMART
Pfam:7tm_2	831	1067	1.2e-66	PFAM
Pfam:Latrophilin	1087	1123	2.2e-4	PFAM

Meta Mutation Damage Score

0.0758

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the latrophilin subfamily of G-protein coupled receptors. The encoded protein participates in the regulation of exocytosis. The proprotein is thought to be further cleaved within a cysteine-rich G-protein-coupled receptor proteolysis site into two chains that are non-covalently bound at the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice die prenatally at fetal stages. Heterozygous mice exhibit decreased locomotor activity in an open field test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	C	5: 63,896,490		probably benign	Het
1700066M21Rik	T	A	1: 57,383,075	N203K	probably benign	Het
1700125H20Rik	A	G	11: 85,173,284	S84G	probably damaging	Het
Adcy9	A	G	16: 4,311,588	L715P	probably damaging	Het
Amer2	A	G	14: 60,378,551	D65G	probably damaging	Het
Aox2	G	T	1: 58,304,438	V427L	possibly damaging	Het
Atad2b	C	A	12: 4,939,689	N133K	possibly damaging	Het
Bptf	A	T	11: 107,074,476	D1182E	probably damaging	Het
Camk1g	T	C	1: 193,359,807	T45A	possibly damaging	Het
Caps2	C	A	10: 112,182,486	Y180*	probably null	Het
Cfap54	T	A	10: 93,045,278	K349N	probably damaging	Het
Ciz1	A	G	2: 32,370,063	D207G	probably benign	Het
Copa	T	A	1: 172,091,233	C127S	probably damaging	Het
Crabp2	A	T	3: 87,952,177	K45*	probably null	Het
Daam1	C	A	12: 71,947,098	T425K	unknown	Het
Dapk2	T	G	9: 66,254,611	V267G	probably damaging	Het
Disp1	T	C	1: 183,087,242	K1205E	probably benign	Het
Dlg4	G	C	11: 70,017,225	R4T	probably damaging	Het
Fbf1	A	G	11: 116,148,220	I743T	probably damaging	Het
Fen1	A	G	19: 10,200,291	L263P	probably damaging	Het
G6pc2	A	G	2: 69,220,112	N27S	probably damaging	Het
Garnl3	A	T	2: 33,034,711	N246K	probably damaging	Het
Gm7337	A	C	5: 87,851,557		noncoding transcript	Het
Gpr152	A	G	19: 4,142,714	T85A	probably benign	Het
Hnrnpu	T	C	1: 178,331,125		probably benign	Het
Ighv1-81	C	G	12: 115,920,329	E101Q	probably benign	Het
Ipo9	T	C	1: 135,409,476	T174A	probably benign	Het
Myo9a	C	T	9: 59,832,315		probably benign	Het
Nup155	G	T	15: 8,148,383	R1083S	possibly damaging	Het
Olfr1351	C	A	10: 79,017,604	T94N	probably benign	Het
Olfr213	C	T	6: 116,540,846	A131V	probably damaging	Het
Olfr262	T	C	19: 12,241,496	H55R	probably benign	Het
Olfr739	T	A	14: 50,425,031	C171S	probably damaging	Het
Phyh	T	A	2: 4,937,671		probably benign	Het
Pkp4	G	T	2: 59,308,105	R233M	probably damaging	Het
Plcb1	A	T	2: 135,335,482	Q578L	probably benign	Het
Ppil3	A	T	1: 58,434,414	N92K	probably benign	Het
Prokr1	C	T	6: 87,588,431	R144H	probably damaging	Het
Psap	T	C	10: 60,277,753	L4P	possibly damaging	Het
Rai14	T	C	15: 10,633,164	T47A	possibly damaging	Het
Rps2	G	T	17: 24,720,978	A129S	probably benign	Het
Sult2a4	T	C	7: 13,989,471	T40A	probably benign	Het
Tacr2	A	G	10: 62,265,245	D378G	probably benign	Het
Topaz1	T	C	9: 122,749,381	I452T	probably benign	Het
Ttn	A	G	2: 76,833,237		probably benign	Het
Vmn2r115	T	A	17: 23,357,024	M532K	possibly damaging	Het
Vmn2r117	A	G	17: 23,460,378	L624P	probably damaging	Het
Vstm5	T	G	9: 15,257,298	S53A	probably benign	Het
Wipf1	C	T	2: 73,434,949	E437K	probably damaging	Het
Wls	G	T	3: 159,897,436	C162F	probably damaging	Het
Yeats2	T	C	16: 20,193,645	V531A	probably damaging	Het
Zfp868	A	G	8: 69,612,085	S200P	probably benign	Het

Other mutations in Adgrl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Adgrl2	APN	3	148865608	missense	probably damaging	0.99
IGL00572:Adgrl2	APN	3	148826498	missense	probably damaging	1.00
IGL01624:Adgrl2	APN	3	148836527	missense	probably damaging	1.00
IGL01796:Adgrl2	APN	3	148858975	missense	probably damaging	1.00
IGL02380:Adgrl2	APN	3	148828489	nonsense	probably null
IGL02468:Adgrl2	APN	3	148890480	missense	probably damaging	1.00
IGL02708:Adgrl2	APN	3	148826525	missense	probably damaging	0.96
IGL02869:Adgrl2	APN	3	148890605	missense	probably damaging	1.00
IGL03248:Adgrl2	APN	3	148817400	missense	probably damaging	1.00
IGL03343:Adgrl2	APN	3	148859380	missense	probably damaging	0.98
P0157:Adgrl2	UTSW	3	148859063	missense	probably damaging	1.00
PIT4382001:Adgrl2	UTSW	3	148817298	missense
PIT4544001:Adgrl2	UTSW	3	148890521	missense	probably damaging	1.00
R0165:Adgrl2	UTSW	3	148852863	splice site	probably benign
R0242:Adgrl2	UTSW	3	148839185	splice site	probably null
R0242:Adgrl2	UTSW	3	148839185	splice site	probably null
R0344:Adgrl2	UTSW	3	148865595	splice site	probably null
R0488:Adgrl2	UTSW	3	148846905	missense	probably damaging	1.00
R0542:Adgrl2	UTSW	3	148859218	missense	probably damaging	1.00
R0630:Adgrl2	UTSW	3	148839244	missense	probably damaging	0.98
R0674:Adgrl2	UTSW	3	148837679	missense	possibly damaging	0.91
R1401:Adgrl2	UTSW	3	148822981	missense	probably damaging	0.99
R1543:Adgrl2	UTSW	3	148859273	missense	probably damaging	1.00
R1575:Adgrl2	UTSW	3	148852762	missense	probably benign	0.17
R1645:Adgrl2	UTSW	3	148865608	missense	probably damaging	1.00
R1780:Adgrl2	UTSW	3	148852593	missense	probably damaging	1.00
R1992:Adgrl2	UTSW	3	148817244	missense	possibly damaging	0.89
R2014:Adgrl2	UTSW	3	148826475	missense	probably damaging	1.00
R2130:Adgrl2	UTSW	3	148890488	missense	probably damaging	0.99
R2131:Adgrl2	UTSW	3	148890488	missense	probably damaging	0.99
R2400:Adgrl2	UTSW	3	148851934	missense	probably damaging	1.00
R2997:Adgrl2	UTSW	3	148817649	missense	probably damaging	1.00
R3416:Adgrl2	UTSW	3	148859329	missense	probably damaging	1.00
R3417:Adgrl2	UTSW	3	148859329	missense	probably damaging	1.00
R3551:Adgrl2	UTSW	3	148858963	missense	probably damaging	1.00
R3760:Adgrl2	UTSW	3	148817235	missense	probably damaging	1.00
R4355:Adgrl2	UTSW	3	148839152	missense	probably damaging	1.00
R4850:Adgrl2	UTSW	3	148859020	missense	probably damaging	1.00
R4911:Adgrl2	UTSW	3	148890463	missense	probably damaging	0.99
R4945:Adgrl2	UTSW	3	148823036	missense	probably damaging	0.99
R5313:Adgrl2	UTSW	3	148823713	missense	probably damaging	1.00
R5339:Adgrl2	UTSW	3	148817844	missense	probably benign	0.01
R5540:Adgrl2	UTSW	3	148837562	critical splice donor site	probably null
R5583:Adgrl2	UTSW	3	148859164	missense	probably damaging	1.00
R5890:Adgrl2	UTSW	3	148859175	missense	probably damaging	1.00
R6170:Adgrl2	UTSW	3	148823009	missense	probably damaging	1.00
R6197:Adgrl2	UTSW	3	148858942	missense	probably damaging	1.00
R6284:Adgrl2	UTSW	3	148826507	missense	probably damaging	1.00
R6877:Adgrl2	UTSW	3	148817286	missense	probably damaging	1.00
R7048:Adgrl2	UTSW	3	148846929	missense	probably damaging	1.00
R7205:Adgrl2	UTSW	3	148858949	missense	probably damaging	1.00
R7326:Adgrl2	UTSW	3	148846870	missense	probably benign	0.00
R7348:Adgrl2	UTSW	3	148817766	missense
R7382:Adgrl2	UTSW	3	148817283	missense
R7486:Adgrl2	UTSW	3	148817694	missense
R7498:Adgrl2	UTSW	3	148859216	nonsense	probably null
R7644:Adgrl2	UTSW	3	148839153	missense	probably damaging	1.00
R7690:Adgrl2	UTSW	3	148817298	missense
R7742:Adgrl2	UTSW	3	148836428	missense	probably damaging	1.00
R7745:Adgrl2	UTSW	3	148836458	missense	probably damaging	1.00
R8291:Adgrl2	UTSW	3	148850918	missense	possibly damaging	0.93
R8326:Adgrl2	UTSW	3	148827554	missense
R8343:Adgrl2	UTSW	3	148846906	missense	probably damaging	1.00
R8344:Adgrl2	UTSW	3	148859525	missense	probably damaging	0.98
RF007:Adgrl2	UTSW	3	148839248	missense	probably damaging	1.00
X0009:Adgrl2	UTSW	3	148852654	missense	probably damaging	1.00
X0019:Adgrl2	UTSW	3	148865594	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- TAGCACATGTGGAGATGGCG -3'
(R):5'- GTTAGTGCACAACAACCTCCGG -3'

Sequencing Primer
(F):5'- CCAAGGTTGGGCATACTTTTATAG -3'
(R):5'- GGGGCGGCAACAAAACCC -3'

Posted On

2015-01-23