Incidental Mutation 'R3161:Wls'
List |< first << previous [record 51 of 53] next >> last >|
ID258156
Institutional Source Beutler Lab
Gene Symbol Wls
Ensembl Gene ENSMUSG00000028173
Gene Namewntless WNT ligand secretion mediator
Synonyms5031439A09Rik, Gpr177
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location159839672-159938664 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 159897436 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 162 (C162F)
Ref Sequence ENSEMBL: ENSMUSP00000143475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068952] [ENSMUST00000198878] [ENSMUST00000200191]
Predicted Effect probably damaging
Transcript: ENSMUST00000068952
AA Change: C162F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000067898
Gene: ENSMUSG00000028173
AA Change: C162F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 178 496 3.7e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197328
Predicted Effect probably damaging
Transcript: ENSMUST00000198878
AA Change: C162F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143475
Gene: ENSMUSG00000028173
AA Change: C162F

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 36 47 N/A INTRINSIC
Pfam:MIG-14_Wnt-bd 177 497 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200571
Meta Mutation Damage Score 0.9412 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for null alleles exhibit impaired body axis and triploblastic development dying prior to E10.5. Mice homozygous for a floxed allele activated in keratinocytes exhibit a psoriasiform dermatitis-like phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Wls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Wls APN 3 159901443 nonsense probably null
IGL02065:Wls APN 3 159911356 missense probably damaging 0.99
IGL02073:Wls APN 3 159907253 critical splice donor site probably null
IGL02133:Wls APN 3 159897370 missense probably damaging 1.00
R0374:Wls UTSW 3 159897437 nonsense probably null
R0561:Wls UTSW 3 159873068 missense probably benign 0.32
R1697:Wls UTSW 3 159897358 missense probably benign 0.12
R1791:Wls UTSW 3 159911813 missense probably benign 0.17
R2444:Wls UTSW 3 159907230 missense probably damaging 1.00
R4285:Wls UTSW 3 159934266 missense probably benign
R4468:Wls UTSW 3 159872927 missense probably damaging 0.96
R4472:Wls UTSW 3 159897383 missense probably benign 0.01
R4782:Wls UTSW 3 159897445 missense probably benign 0.03
R4799:Wls UTSW 3 159897445 missense probably benign 0.03
R4809:Wls UTSW 3 159897445 missense probably benign 0.03
R5006:Wls UTSW 3 159911791 missense possibly damaging 0.68
R5212:Wls UTSW 3 159873008 missense probably benign 0.15
R5434:Wls UTSW 3 159934340 missense probably damaging 0.97
R5694:Wls UTSW 3 159839987 missense probably benign 0.01
R6315:Wls UTSW 3 159934371 critical splice donor site probably null
R7069:Wls UTSW 3 159934329 missense probably damaging 1.00
R7243:Wls UTSW 3 159909765 missense possibly damaging 0.49
R7529:Wls UTSW 3 159873007 missense probably benign 0.43
R7697:Wls UTSW 3 159911318 missense probably benign 0.21
R7842:Wls UTSW 3 159873179 missense probably benign 0.09
R8136:Wls UTSW 3 159873124 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTGTGAACATTTTGGAATG -3'
(R):5'- AGTCCTTCAAGAGCAGCTAAG -3'

Sequencing Primer
(F):5'- CATGTTTTCTCTTGCAGGAG -3'
(R):5'- TCAGTGGAAAGTCTAGCCTTTC -3'
Posted On2015-01-23