Incidental Mutation 'R3161:Prokr1'
List |< first << previous [record 39 of 53] next >> last >|
ID258159
Institutional Source Beutler Lab
Gene Symbol Prokr1
Ensembl Gene ENSMUSG00000049409
Gene Nameprokineticin receptor 1
SynonymsPkr1, Gpr73, EG-VEGFR1
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location87578591-87590743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87588431 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 144 (R144H)
Ref Sequence ENSEMBL: ENSMUSP00000144999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050887] [ENSMUST00000203636] [ENSMUST00000204682]
Predicted Effect probably damaging
Transcript: ENSMUST00000050887
AA Change: R144H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000059034
Gene: ENSMUSG00000049409
AA Change: R144H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 73 360 8.8e-8 PFAM
Pfam:7tm_1 79 342 7.2e-47 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000203636
AA Change: V106I
SMART Domains Protein: ENSMUSP00000145476
Gene: ENSMUSG00000049409
AA Change: V106I

DomainStartEndE-ValueType
low complexity region 100 113 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000204682
AA Change: R144H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144999
Gene: ENSMUSG00000049409
AA Change: R144H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 73 360 8.8e-8 PFAM
Pfam:7tm_1 79 342 7.2e-47 PFAM
Meta Mutation Damage Score 0.1516 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G-protein-coupled receptor family. The encoded protein binds to prokineticins (1 and 2), leading to the activation of MAPK and STAT signaling pathways. Prokineticins are protein ligands involved in angiogenesis and inflammation. The encoded protein is expressed in peripheral tissues such as those comprising the circulatory system, lungs, reproductive system, endocrine system and the gastrointestinal system. The protein may be involved in signaling in human fetal ovary during initiation of primordial follicle formation. Sequence variants in this gene may be associated with recurrent miscarriage. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit abnormal nociceptions and hypoalgesia. Mice homozygous for another null allele exhibit decreased capillary density in the heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Prokr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Prokr1 APN 6 87588611 missense probably damaging 1.00
IGL00838:Prokr1 APN 6 87588693 missense possibly damaging 0.94
IGL01083:Prokr1 APN 6 87588784 missense probably benign 0.41
IGL02677:Prokr1 APN 6 87588368 splice site probably benign
IGL03344:Prokr1 APN 6 87588500 missense possibly damaging 0.95
R1953:Prokr1 UTSW 6 87588593 missense probably benign 0.18
R2065:Prokr1 UTSW 6 87588713 missense probably damaging 0.98
R4777:Prokr1 UTSW 6 87588860 start codon destroyed probably null 0.98
R4828:Prokr1 UTSW 6 87581242 missense probably benign 0.07
R4890:Prokr1 UTSW 6 87588696 missense probably benign 0.00
R4943:Prokr1 UTSW 6 87581824 missense possibly damaging 0.90
R6134:Prokr1 UTSW 6 87588855 missense possibly damaging 0.54
R6183:Prokr1 UTSW 6 87588852 missense possibly damaging 0.94
R6329:Prokr1 UTSW 6 87581792 missense possibly damaging 0.94
R6794:Prokr1 UTSW 6 87588693 missense possibly damaging 0.94
R6922:Prokr1 UTSW 6 87588473 missense probably damaging 1.00
R8428:Prokr1 UTSW 6 87588774 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGATGTCCAGTCAGTAGGCTTTTG -3'
(R):5'- GTGGCATCGGCAACTTCATC -3'

Sequencing Primer
(F):5'- CAGTCAGTAGGCTTTTGAGTCCC -3'
(R):5'- GTGGCATCGGCAACTTCATCTTTATC -3'
Posted On2015-01-23