Incidental Mutation 'R3161:Sult2a4'
List |< first << previous [record 43 of 53] next >> last >|
ID258161
Institutional Source Beutler Lab
Gene Symbol Sult2a4
Ensembl Gene ENSMUSG00000074377
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 4
SynonymsGm5584
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location13909676-13989607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13989471 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 40 (T40A)
Ref Sequence ENSEMBL: ENSMUSP00000130490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108520] [ENSMUST00000165167]
Predicted Effect probably benign
Transcript: ENSMUST00000108520
AA Change: T41A

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000104160
Gene: ENSMUSG00000074377
AA Change: T41A

DomainStartEndE-ValueType
Pfam:Sulfotransfer_3 5 205 1.5e-10 PFAM
Pfam:Sulfotransfer_1 34 278 1.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165167
AA Change: T40A

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130490
Gene: ENSMUSG00000074377
AA Change: T40A

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 33 277 1.3e-82 PFAM
Meta Mutation Damage Score 0.4446 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Sult2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Sult2a4 APN 7 13984945 missense probably damaging 1.00
IGL00835:Sult2a4 APN 7 13909789 missense probably benign 0.01
IGL02078:Sult2a4 APN 7 13989544 missense probably benign 0.02
IGL02409:Sult2a4 APN 7 13984919 nonsense probably null
IGL02970:Sult2a4 APN 7 13909906 splice site probably benign
IGL03201:Sult2a4 APN 7 13931767 missense probably damaging 0.97
R0827:Sult2a4 UTSW 7 13984961 missense probably benign 0.03
R1484:Sult2a4 UTSW 7 13909801 missense probably benign
R1523:Sult2a4 UTSW 7 13909860 nonsense probably null
R1613:Sult2a4 UTSW 7 13989495 missense probably damaging 0.98
R2127:Sult2a4 UTSW 7 13915260 missense probably damaging 0.99
R2372:Sult2a4 UTSW 7 13915300 missense probably benign 0.15
R5181:Sult2a4 UTSW 7 13988391 missense probably benign 0.04
R7124:Sult2a4 UTSW 7 13988395 nonsense probably null
R7983:Sult2a4 UTSW 7 13915227 missense probably damaging 1.00
R8214:Sult2a4 UTSW 7 13989476 missense probably benign 0.10
X0028:Sult2a4 UTSW 7 13988241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACAATCATTGTTCTGGTG -3'
(R):5'- TGCTATAAGCTGAATAGGTGTCCTG -3'

Sequencing Primer
(F):5'- CACAATCATTGTTCTGGTGCCATAG -3'
(R):5'- CTGGGCTGGAATTCTAACAGCATC -3'
Posted On2015-01-23