Incidental Mutation 'R3161:Dapk2'
ID258166
Institutional Source Beutler Lab
Gene Symbol Dapk2
Ensembl Gene ENSMUSG00000032380
Gene Namedeath-associated protein kinase 2
Synonyms
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location66158223-66272242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 66254611 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 267 (V267G)
Ref Sequence ENSEMBL: ENSMUSP00000034944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034944]
PDB Structure
CRYSTAL STRUCTURE OF THE AUTOINHIBITED FORM OF MOUSE DAPK2 [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE AUTOINHIBITED FORM OF MOUSE DAPK2 IN COMPLEX WITH ATP [X-RAY DIFFRACTION]
Crystal structure of the autoinhibited form of mouse DAPK2 in complex with AMP [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034944
AA Change: V267G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034944
Gene: ENSMUSG00000032380
AA Change: V267G

DomainStartEndE-ValueType
S_TKc 23 285 6.26e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132987
SMART Domains Protein: ENSMUSP00000117134
Gene: ENSMUSG00000032380

DomainStartEndE-ValueType
Pfam:Pkinase 1 52 2e-14 PFAM
Pfam:Pkinase_Tyr 1 53 1.7e-9 PFAM
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase family. This protein contains a N-terminal protein kinase domain followed by a conserved calmodulin-binding domain with significant similarity to that of death-associated protein kinase 1 (DAPK1), a positive regulator of programmed cell death. Overexpression of this gene was shown to induce cell apoptosis. It uses multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Dapk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Dapk2 APN 9 66268778 splice site probably benign
IGL01304:Dapk2 APN 9 66231857 splice site probably benign
IGL02053:Dapk2 APN 9 66220745 missense probably benign 0.02
IGL02351:Dapk2 APN 9 66246523 missense probably damaging 0.99
IGL02358:Dapk2 APN 9 66246523 missense probably damaging 0.99
IGL02736:Dapk2 APN 9 66268916 missense probably benign
IGL02742:Dapk2 APN 9 66231814 missense probably damaging 1.00
PIT4618001:Dapk2 UTSW 9 66268686 missense probably benign 0.01
R0367:Dapk2 UTSW 9 66268886 missense probably damaging 0.99
R1375:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1376:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1376:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1752:Dapk2 UTSW 9 66220643 missense probably damaging 0.97
R1924:Dapk2 UTSW 9 66165360 missense probably benign 0.05
R1981:Dapk2 UTSW 9 66268898 missense probably benign 0.00
R3160:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R3162:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R3162:Dapk2 UTSW 9 66254611 missense probably damaging 0.99
R5394:Dapk2 UTSW 9 66268718 missense probably benign 0.00
R6750:Dapk2 UTSW 9 66220752 missense probably damaging 1.00
R6951:Dapk2 UTSW 9 66254622 missense probably benign 0.01
R6952:Dapk2 UTSW 9 66254622 missense probably benign 0.01
R6953:Dapk2 UTSW 9 66254622 missense probably benign 0.01
Z1088:Dapk2 UTSW 9 66246477 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- GTGAACTGGGTTAGACTGCAC -3'
(R):5'- GTGCATGCTCATGTAGACAGAG -3'

Sequencing Primer
(F):5'- CTGGGTTAGACTGCACTGAAAAATC -3'
(R):5'- GCTCATGTAGACAGAGACATTTG -3'
Posted On2015-01-23