Incidental Mutation 'R3161:Fbf1'
ID258177
Institutional Source Beutler Lab
Gene Symbol Fbf1
Ensembl Gene ENSMUSG00000020776
Gene NameFas (TNFRSF6) binding factor 1
Synonyms1110033G01Rik
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location116142285-116168166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116148220 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 743 (I743T)
Ref Sequence ENSEMBL: ENSMUSP00000102043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103031] [ENSMUST00000106435]
Predicted Effect probably damaging
Transcript: ENSMUST00000103031
AA Change: I743T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099320
Gene: ENSMUSG00000020776
AA Change: I743T

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106435
AA Change: I743T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102043
Gene: ENSMUSG00000020776
AA Change: I743T

DomainStartEndE-ValueType
low complexity region 33 44 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
low complexity region 201 216 N/A INTRINSIC
coiled coil region 617 745 N/A INTRINSIC
SCOP:d1sig__ 808 975 9e-3 SMART
low complexity region 976 1005 N/A INTRINSIC
low complexity region 1031 1068 N/A INTRINSIC
low complexity region 1110 1130 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136318
Meta Mutation Damage Score 0.0803 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Fbf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Fbf1 APN 11 116151081 missense probably benign 0.00
IGL01420:Fbf1 APN 11 116145996 missense probably benign 0.07
IGL01971:Fbf1 APN 11 116143382 unclassified probably benign
IGL01995:Fbf1 APN 11 116151020 missense probably null 0.00
IGL02639:Fbf1 APN 11 116152600 missense probably benign 0.14
IGL02884:Fbf1 APN 11 116146513 missense probably damaging 1.00
IGL03001:Fbf1 APN 11 116165886 start gained probably benign
IGL03309:Fbf1 APN 11 116147811 missense probably damaging 1.00
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0098:Fbf1 UTSW 11 116148119 critical splice donor site probably null
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0234:Fbf1 UTSW 11 116155034 missense probably damaging 1.00
R0257:Fbf1 UTSW 11 116155091 missense probably benign 0.05
R0394:Fbf1 UTSW 11 116152462 unclassified probably benign
R0637:Fbf1 UTSW 11 116160054 unclassified probably benign
R1512:Fbf1 UTSW 11 116147927 missense probably damaging 1.00
R1679:Fbf1 UTSW 11 116151017 critical splice donor site probably null
R1726:Fbf1 UTSW 11 116145454 missense probably benign
R1909:Fbf1 UTSW 11 116145992 missense possibly damaging 0.79
R1970:Fbf1 UTSW 11 116151491 missense possibly damaging 0.93
R2507:Fbf1 UTSW 11 116155426 missense probably benign
R2847:Fbf1 UTSW 11 116157688 critical splice donor site probably null
R2849:Fbf1 UTSW 11 116157688 critical splice donor site probably null
R2867:Fbf1 UTSW 11 116161448 unclassified probably benign
R3711:Fbf1 UTSW 11 116161473 missense possibly damaging 0.66
R3711:Fbf1 UTSW 11 116163353 missense probably damaging 1.00
R3752:Fbf1 UTSW 11 116147796 missense probably benign 0.21
R4293:Fbf1 UTSW 11 116148894 missense probably damaging 1.00
R4344:Fbf1 UTSW 11 116147742 missense probably benign
R4345:Fbf1 UTSW 11 116147742 missense probably benign
R4604:Fbf1 UTSW 11 116158922 missense possibly damaging 0.81
R4828:Fbf1 UTSW 11 116148951 missense probably benign 0.00
R4936:Fbf1 UTSW 11 116152552 missense probably benign 0.05
R5561:Fbf1 UTSW 11 116157820 missense probably damaging 1.00
R6392:Fbf1 UTSW 11 116152949 critical splice acceptor site probably null
R6559:Fbf1 UTSW 11 116155446 missense probably benign 0.15
R6993:Fbf1 UTSW 11 116152784 missense probably benign
R7207:Fbf1 UTSW 11 116149474 missense probably benign 0.01
R7544:Fbf1 UTSW 11 116165833 missense probably benign 0.01
R7988:Fbf1 UTSW 11 116152768 missense probably benign 0.00
R8230:Fbf1 UTSW 11 116146739 missense probably benign
R8262:Fbf1 UTSW 11 116154019 missense probably benign 0.19
X0020:Fbf1 UTSW 11 116150793 missense possibly damaging 0.78
X0060:Fbf1 UTSW 11 116148856 nonsense probably null
X0062:Fbf1 UTSW 11 116149426 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CTGCTCGATGATGCCATTCAG -3'
(R):5'- GGTATCTGTGGCATGGAAGCAG -3'

Sequencing Primer
(F):5'- ATGATGCCATTCAGGGACCTG -3'
(R):5'- CTGTGGCATGGAAGCAGCAATAG -3'
Posted On2015-01-23