Incidental Mutation 'R3161:Nup155'
ID258183
Institutional Source Beutler Lab
Gene Symbol Nup155
Ensembl Gene ENSMUSG00000022142
Gene Namenucleoporin 155
SynonymsD930027M19Rik
MMRRC Submission 040612-MU
Accession Numbers

Genbank: NM_133227

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location8109273-8161247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 8148383 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 1083 (R1083S)
Ref Sequence ENSEMBL: ENSMUSP00000128819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163765
AA Change: R1083S

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: R1083S

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Nucleoporin_N 77 510 3.5e-105 PFAM
low complexity region 600 619 N/A INTRINSIC
Pfam:Nucleoporin_C 678 1221 3.6e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229039
Predicted Effect possibly damaging
Transcript: ENSMUST00000230017
AA Change: R1083S

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230925
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Nup155
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nup155 APN 15 8121455 splice site probably benign
IGL00426:Nup155 APN 15 8156794 makesense probably null
IGL00765:Nup155 APN 15 8153228 missense probably benign 0.16
IGL00936:Nup155 APN 15 8128405 splice site probably benign
IGL01124:Nup155 APN 15 8153679 missense probably damaging 0.97
IGL01739:Nup155 APN 15 8135788 missense probably benign 0.01
IGL02013:Nup155 APN 15 8113648 missense possibly damaging 0.61
IGL02066:Nup155 APN 15 8157766 unclassified probably benign
IGL02231:Nup155 APN 15 8144064 missense probably damaging 1.00
IGL02246:Nup155 APN 15 8143002 missense probably benign
IGL02289:Nup155 APN 15 8131493 missense probably damaging 1.00
IGL02608:Nup155 APN 15 8109471 missense probably benign
IGL02749:Nup155 APN 15 8134076 missense probably damaging 1.00
IGL02813:Nup155 APN 15 8130121 splice site probably benign
IGL03102:Nup155 APN 15 8147284 missense probably benign 0.00
H8930:Nup155 UTSW 15 8157658 missense possibly damaging 0.50
IGL02835:Nup155 UTSW 15 8143130 missense probably damaging 1.00
R0314:Nup155 UTSW 15 8147252 missense probably benign 0.00
R0365:Nup155 UTSW 15 8131543 missense probably damaging 1.00
R0586:Nup155 UTSW 15 8130232 missense probably benign 0.39
R0764:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R0839:Nup155 UTSW 15 8145587 missense possibly damaging 0.48
R0844:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1066:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1067:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1085:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1137:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1162:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1166:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1202:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1203:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1219:Nup155 UTSW 15 8117338 missense possibly damaging 0.80
R1385:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1421:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1448:Nup155 UTSW 15 8112406 missense probably benign 0.44
R1611:Nup155 UTSW 15 8130160 missense probably damaging 1.00
R1836:Nup155 UTSW 15 8154980 missense possibly damaging 0.79
R1863:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1866:Nup155 UTSW 15 8115526 missense probably damaging 1.00
R1894:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R1976:Nup155 UTSW 15 8135827 missense probably benign 0.01
R2024:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2026:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2027:Nup155 UTSW 15 8157760 missense probably damaging 1.00
R2077:Nup155 UTSW 15 8143026 missense probably damaging 1.00
R2111:Nup155 UTSW 15 8121467 missense probably benign 0.45
R2921:Nup155 UTSW 15 8153641 missense probably damaging 1.00
R2936:Nup155 UTSW 15 8143049 missense possibly damaging 0.89
R3108:Nup155 UTSW 15 8117306 missense probably null 1.00
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3162:Nup155 UTSW 15 8148383 missense possibly damaging 0.56
R3522:Nup155 UTSW 15 8156678 splice site probably benign
R4423:Nup155 UTSW 15 8121464 missense probably damaging 0.99
R4451:Nup155 UTSW 15 8150882 missense probably benign 0.02
R4498:Nup155 UTSW 15 8153673 missense possibly damaging 0.88
R4780:Nup155 UTSW 15 8157703 missense probably benign 0.00
R4822:Nup155 UTSW 15 8128526 missense possibly damaging 0.49
R5013:Nup155 UTSW 15 8124238 missense probably benign 0.00
R5064:Nup155 UTSW 15 8135870 missense probably damaging 1.00
R5172:Nup155 UTSW 15 8109542 missense probably benign 0.06
R5406:Nup155 UTSW 15 8153638 critical splice acceptor site probably null
R5551:Nup155 UTSW 15 8148333 missense probably benign 0.09
R5588:Nup155 UTSW 15 8119253 critical splice donor site probably null
R5977:Nup155 UTSW 15 8130237 critical splice donor site probably null
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6035:Nup155 UTSW 15 8144093 missense probably benign
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6036:Nup155 UTSW 15 8128411 missense probably benign 0.16
R6085:Nup155 UTSW 15 8148358 missense probably damaging 0.98
R6188:Nup155 UTSW 15 8109575 missense probably damaging 1.00
R6232:Nup155 UTSW 15 8109479 missense probably benign 0.02
R6257:Nup155 UTSW 15 8150798 nonsense probably null
R6262:Nup155 UTSW 15 8156741 missense probably benign 0.03
R6267:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6296:Nup155 UTSW 15 8153155 missense probably damaging 1.00
R6299:Nup155 UTSW 15 8128438 missense possibly damaging 0.88
R6303:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6304:Nup155 UTSW 15 8118042 missense probably damaging 1.00
R6763:Nup155 UTSW 15 8135895 nonsense probably null
R6958:Nup155 UTSW 15 8147154 missense probably damaging 1.00
R7088:Nup155 UTSW 15 8156693 missense probably benign 0.11
R7313:Nup155 UTSW 15 8154922 missense probably damaging 0.96
R7451:Nup155 UTSW 15 8145607 nonsense probably null
R7560:Nup155 UTSW 15 8155047 missense probably benign 0.39
R7633:Nup155 UTSW 15 8109453 missense probably damaging 0.99
R7670:Nup155 UTSW 15 8153696 missense probably damaging 0.99
R7726:Nup155 UTSW 15 8122139 missense probably damaging 1.00
R7752:Nup155 UTSW 15 8116442 missense possibly damaging 0.53
R7889:Nup155 UTSW 15 8121507 missense probably damaging 0.98
R7899:Nup155 UTSW 15 8119179 missense probably damaging 1.00
R7901:Nup155 UTSW 15 8116442 missense possibly damaging 0.53
RF003:Nup155 UTSW 15 8119176 critical splice acceptor site probably benign
RF048:Nup155 UTSW 15 8119176 critical splice acceptor site probably benign
Z1177:Nup155 UTSW 15 8120489 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCAGAATACAAGGCACATGCG -3'
(R):5'- AAGTCAGTGGCTCCCAAGAG -3'

Sequencing Primer
(F):5'- TGTGGCTGCAATTTCCAG -3'
(R):5'- AGTCCAGAGCTCTAGATGATCTG -3'
Posted On2015-01-23