Mutagenetix > Incidental Mutation

Incidental Mutation 'R3161:Rai14'

258184

Institutional Source

Beutler Lab

Gene Symbol

Rai14

Ensembl Gene

ENSMUSG00000022246

Gene Name

retinoic acid induced 14

Synonyms

1700008J19Rik, 1700020L11Rik, Ankycorbin, Norpeg

MMRRC Submission

040612-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.396) question?

Stock #

R3161 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10568969-10714624 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 10633164 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 47 (T47A)

Ref Sequence

ENSEMBL: ENSMUSP00000153969 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]

AlphaFold

Q9EP71

Predicted Effect

probably benign
Transcript: ENSMUST00000090339
AA Change: T47A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: T47A

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000169385
AA Change: T47A

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: T47A

Domain	Start	End	E-Value	Type
Blast:ANK	18	48	4e-10	BLAST
ANK	52	81	1.66e-6	SMART
ANK	85	117	7.02e-5	SMART
ANK	118	147	2.1e-3	SMART
ANK	151	180	2.16e-5	SMART
ANK	184	213	2.85e-5	SMART
ANK	217	247	9.33e2	SMART
low complexity region	343	357	N/A	INTRINSIC
Blast:HAMP	595	646	6e-19	BLAST
low complexity region	897	931	N/A	INTRINSIC
Blast:ANK	944	977	6e-13	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226530

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227464

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227506
AA Change: T47A

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.0974

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.3%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	T	C	5: 63,896,490		probably benign	Het
1700066M21Rik	T	A	1: 57,383,075	N203K	probably benign	Het
1700125H20Rik	A	G	11: 85,173,284	S84G	probably damaging	Het
Adcy9	A	G	16: 4,311,588	L715P	probably damaging	Het
Adgrl2	G	A	3: 148,817,551	L1354F	probably damaging	Het
Amer2	A	G	14: 60,378,551	D65G	probably damaging	Het
Aox2	G	T	1: 58,304,438	V427L	possibly damaging	Het
Atad2b	C	A	12: 4,939,689	N133K	possibly damaging	Het
Bptf	A	T	11: 107,074,476	D1182E	probably damaging	Het
Camk1g	T	C	1: 193,359,807	T45A	possibly damaging	Het
Caps2	C	A	10: 112,182,486	Y180*	probably null	Het
Cfap54	T	A	10: 93,045,278	K349N	probably damaging	Het
Ciz1	A	G	2: 32,370,063	D207G	probably benign	Het
Copa	T	A	1: 172,091,233	C127S	probably damaging	Het
Crabp2	A	T	3: 87,952,177	K45*	probably null	Het
Daam1	C	A	12: 71,947,098	T425K	unknown	Het
Dapk2	T	G	9: 66,254,611	V267G	probably damaging	Het
Disp1	T	C	1: 183,087,242	K1205E	probably benign	Het
Dlg4	G	C	11: 70,017,225	R4T	probably damaging	Het
Fbf1	A	G	11: 116,148,220	I743T	probably damaging	Het
Fen1	A	G	19: 10,200,291	L263P	probably damaging	Het
G6pc2	A	G	2: 69,220,112	N27S	probably damaging	Het
Garnl3	A	T	2: 33,034,711	N246K	probably damaging	Het
Gm7337	A	C	5: 87,851,557		noncoding transcript	Het
Gpr152	A	G	19: 4,142,714	T85A	probably benign	Het
Hnrnpu	T	C	1: 178,331,125		probably benign	Het
Ighv1-81	C	G	12: 115,920,329	E101Q	probably benign	Het
Ipo9	T	C	1: 135,409,476	T174A	probably benign	Het
Myo9a	C	T	9: 59,832,315		probably benign	Het
Nup155	G	T	15: 8,148,383	R1083S	possibly damaging	Het
Olfr1351	C	A	10: 79,017,604	T94N	probably benign	Het
Olfr213	C	T	6: 116,540,846	A131V	probably damaging	Het
Olfr262	T	C	19: 12,241,496	H55R	probably benign	Het
Olfr739	T	A	14: 50,425,031	C171S	probably damaging	Het
Phyh	T	A	2: 4,937,671		probably benign	Het
Pkp4	G	T	2: 59,308,105	R233M	probably damaging	Het
Plcb1	A	T	2: 135,335,482	Q578L	probably benign	Het
Ppil3	A	T	1: 58,434,414	N92K	probably benign	Het
Prokr1	C	T	6: 87,588,431	R144H	probably damaging	Het
Psap	T	C	10: 60,277,753	L4P	possibly damaging	Het
Rps2	G	T	17: 24,720,978	A129S	probably benign	Het
Sult2a4	T	C	7: 13,989,471	T40A	probably benign	Het
Tacr2	A	G	10: 62,265,245	D378G	probably benign	Het
Topaz1	T	C	9: 122,749,381	I452T	probably benign	Het
Ttn	A	G	2: 76,833,237		probably benign	Het
Vmn2r115	T	A	17: 23,357,024	M532K	possibly damaging	Het
Vmn2r117	A	G	17: 23,460,378	L624P	probably damaging	Het
Vstm5	T	G	9: 15,257,298	S53A	probably benign	Het
Wipf1	C	T	2: 73,434,949	E437K	probably damaging	Het
Wls	G	T	3: 159,897,436	C162F	probably damaging	Het
Yeats2	T	C	16: 20,193,645	V531A	probably damaging	Het
Zfp868	A	G	8: 69,612,085	S200P	probably benign	Het

Other mutations in Rai14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Rai14	APN	15	10599711	splice site	probably benign
IGL01625:Rai14	APN	15	10572374	missense	probably benign	0.30
IGL01925:Rai14	APN	15	10595862	missense	possibly damaging	0.88
IGL02053:Rai14	APN	15	10633156	missense	probably benign	0.00
IGL02531:Rai14	APN	15	10574782	missense	probably damaging	1.00
IGL02748:Rai14	APN	15	10589335	missense	probably benign	0.14
IGL02945:Rai14	APN	15	10574709	missense	probably benign	0.00
PIT4618001:Rai14	UTSW	15	10575156	missense	probably damaging	1.00
R1400:Rai14	UTSW	15	10571548	missense	probably damaging	0.98
R1583:Rai14	UTSW	15	10587916	missense	probably damaging	1.00
R1686:Rai14	UTSW	15	10592196	missense	probably damaging	0.98
R1721:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1867:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1868:Rai14	UTSW	15	10633228	missense	probably damaging	1.00
R1998:Rai14	UTSW	15	10594981	splice site	probably null
R2118:Rai14	UTSW	15	10575166	missense	probably benign	0.00
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R3162:Rai14	UTSW	15	10633164	missense	possibly damaging	0.74
R4049:Rai14	UTSW	15	10592212	missense	probably benign	0.30
R4611:Rai14	UTSW	15	10592138	missense	probably damaging	1.00
R4760:Rai14	UTSW	15	10575690	missense	possibly damaging	0.60
R4863:Rai14	UTSW	15	10572470	missense	probably damaging	0.99
R5022:Rai14	UTSW	15	10574506	missense	probably damaging	0.96
R5110:Rai14	UTSW	15	10690410	start gained	probably benign
R5410:Rai14	UTSW	15	10574938	missense	probably damaging	1.00
R5643:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5644:Rai14	UTSW	15	10593051	missense	probably benign	0.03
R5681:Rai14	UTSW	15	10575120	missense	probably damaging	1.00
R5934:Rai14	UTSW	15	10575159	missense	probably damaging	0.98
R6333:Rai14	UTSW	15	10574936	nonsense	probably null
R6338:Rai14	UTSW	15	10574976	missense	probably damaging	1.00
R6864:Rai14	UTSW	15	10633168	missense	possibly damaging	0.95
R7015:Rai14	UTSW	15	10589315	nonsense	probably null
R7155:Rai14	UTSW	15	10595003	missense	possibly damaging	0.53
R7480:Rai14	UTSW	15	10571536	missense	probably benign	0.02
R7574:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7578:Rai14	UTSW	15	10574828	missense	probably benign
R7578:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7597:Rai14	UTSW	15	10574851	missense	possibly damaging	0.94
R7658:Rai14	UTSW	15	10593103	missense	probably damaging	1.00
R7779:Rai14	UTSW	15	10593026	missense	probably damaging	1.00
R7946:Rai14	UTSW	15	10574201	splice site	probably null
R8171:Rai14	UTSW	15	10633163	missense	probably damaging	1.00
R8195:Rai14	UTSW	15	10575216	missense	probably benign
R8471:Rai14	UTSW	15	10575159	missense	probably benign	0.01
R8485:Rai14	UTSW	15	10575036	missense	probably damaging	1.00
R9075:Rai14	UTSW	15	10589317	missense	probably damaging	1.00
R9287:Rai14	UTSW	15	10592118	missense	probably benign	0.14
R9502:Rai14	UTSW	15	10587861	missense	possibly damaging	0.50
R9603:Rai14	UTSW	15	10595030	nonsense	probably null
R9665:Rai14	UTSW	15	10574717	missense	probably damaging	1.00
R9767:Rai14	UTSW	15	10610041	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGCATTGGTCAAACTCCCCTTG -3'
(R):5'- GTTGTTCCCACGGTGAAGTG -3'

Sequencing Primer
(F):5'- TCCCCTTGATGAATAAGTCAGC -3'
(R):5'- AAGGCGGTTTTGAAAGCTGC -3'

Posted On

2015-01-23