Incidental Mutation 'R3161:Rps2'
ID258190
Institutional Source Beutler Lab
Gene Symbol Rps2
Ensembl Gene ENSMUSG00000044533
Gene Nameribosomal protein S2
SynonymsLlrep3, Rps2
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R3161 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24718116-24721929 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24720978 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 129 (A129S)
Ref Sequence ENSEMBL: ENSMUSP00000120715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008626] [ENSMUST00000045602] [ENSMUST00000054289] [ENSMUST00000135708] [ENSMUST00000146867] [ENSMUST00000152407] [ENSMUST00000170715]
Predicted Effect probably benign
Transcript: ENSMUST00000008626
SMART Domains Protein: ENSMUSP00000008626
Gene: ENSMUSG00000008482

DomainStartEndE-ValueType
RING 20 57 1.76e-5 SMART
Pfam:zf-TRAF 102 158 7.5e-9 PFAM
low complexity region 176 193 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045602
SMART Domains Protein: ENSMUSP00000043543
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 42 168 2.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054289
AA Change: A129S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000092502
Gene: ENSMUSG00000044533
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 5.7e-34 PFAM
Pfam:Ribosomal_S5_C 185 256 2.4e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132803
Predicted Effect probably benign
Transcript: ENSMUST00000135708
SMART Domains Protein: ENSMUSP00000120091
Gene: ENSMUSG00000040048

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 54 149 7.1e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144285
Predicted Effect probably benign
Transcript: ENSMUST00000146867
AA Change: A129S

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120715
Gene: ENSMUSG00000044533
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 1.7e-35 PFAM
Pfam:Ribosomal_S5_C 185 256 8.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147648
Predicted Effect probably benign
Transcript: ENSMUST00000152407
AA Change: A129S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114529
Gene: ENSMUSG00000044533
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 9.2e-32 PFAM
Pfam:Ribosomal_S5_C 184 257 1.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170715
AA Change: A129S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131474
Gene: ENSMUSG00000044533
AA Change: A129S

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 1.1e-31 PFAM
Pfam:Ribosomal_S5_C 184 257 1.3e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161706
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S5P family of ribosomal proteins. It is located in the cytoplasm. This gene shares sequence similarity with mouse LLRep3. It is co-transcribed with the small nucleolar RNA gene U64, which is located in its third intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
Fen1 A G 19: 10,200,291 L263P probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Rps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02836:Rps2 APN 17 24720676 missense probably damaging 1.00
IGL02981:Rps2 APN 17 24721724 missense probably benign 0.00
IGL03123:Rps2 APN 17 24720289 unclassified probably benign
R2504:Rps2 UTSW 17 24720379 unclassified probably benign
R3160:Rps2 UTSW 17 24720978 missense probably benign 0.16
R3162:Rps2 UTSW 17 24720978 missense probably benign 0.16
R5877:Rps2 UTSW 17 24720916 intron probably benign
R7247:Rps2 UTSW 17 24720580 missense possibly damaging 0.86
R8135:Rps2 UTSW 17 24720435 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ACCCGTGTGACTTTCGTAC -3'
(R):5'- AGACAATGCCAGTGCCTCTG -3'

Sequencing Primer
(F):5'- GTGACTTTCGTACGGAGAGAG -3'
(R):5'- GGATGAGACGCACCAGCAC -3'
Posted On2015-01-23