Incidental Mutation 'R3161:Fen1'
ID258192
Institutional Source Beutler Lab
Gene Symbol Fen1
Ensembl Gene ENSMUSG00000024742
Gene Nameflap structure specific endonuclease 1
Synonyms
MMRRC Submission 040612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3161 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10199132-10204169 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10200291 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 263 (L263P)
Ref Sequence ENSEMBL: ENSMUSP00000117246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010807] [ENSMUST00000025651] [ENSMUST00000040372] [ENSMUST00000116542] [ENSMUST00000142241] [ENSMUST00000156291]
Predicted Effect probably benign
Transcript: ENSMUST00000010807
SMART Domains Protein: ENSMUSP00000010807
Gene: ENSMUSG00000010663

DomainStartEndE-ValueType
Cyt-b5 22 97 1.32e-19 SMART
transmembrane domain 134 156 N/A INTRINSIC
Pfam:FA_desaturase 158 421 7.4e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025651
AA Change: L263P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025651
Gene: ENSMUSG00000024742
AA Change: L263P

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040372
SMART Domains Protein: ENSMUSP00000044751
Gene: ENSMUSG00000036372

DomainStartEndE-ValueType
Pfam:UPF0197 3 79 3.3e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081739
Predicted Effect probably damaging
Transcript: ENSMUST00000116542
AA Change: L263P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112241
Gene: ENSMUSG00000024742
AA Change: L263P

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127878
Predicted Effect probably damaging
Transcript: ENSMUST00000142241
AA Change: L263P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119221
Gene: ENSMUSG00000024742
AA Change: L263P

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153854
Predicted Effect probably damaging
Transcript: ENSMUST00000156291
AA Change: L263P

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117246
Gene: ENSMUSG00000024742
AA Change: L263P

DomainStartEndE-ValueType
XPGN 1 107 2.5e-60 SMART
XPGI 146 218 2.22e-34 SMART
HhH2 220 253 1.41e-13 SMART
low complexity region 354 380 N/A INTRINSIC
Meta Mutation Damage Score 0.4562 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene removes 5' overhanging flaps in DNA repair and processes the 5' ends of Okazaki fragments in lagging strand DNA synthesis. Direct physical interaction between this protein and AP endonuclease 1 during long-patch base excision repair provides coordinated loading of the proteins onto the substrate, thus passing the substrate from one enzyme to another. The protein is a member of the XPG/RAD2 endonuclease family and is one of ten proteins essential for cell-free DNA replication. DNA secondary structure can inhibit flap processing at certain trinucleotide repeats in a length-dependent manner by concealing the 5' end of the flap that is necessary for both binding and cleavage by the protein encoded by this gene. Therefore, secondary structure can deter the protective function of this protein, leading to site-specific trinucleotide expansions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants do not form an inner cell mass, lack DNA synthesis in blastocyst giant cells and die by embryonic day 9.5. Embryonic day 3.5 blastocysts are hypersensitive to irradiation. Heterozygotes show enhanced adenocarcinoma susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,896,490 probably benign Het
1700066M21Rik T A 1: 57,383,075 N203K probably benign Het
1700125H20Rik A G 11: 85,173,284 S84G probably damaging Het
Adcy9 A G 16: 4,311,588 L715P probably damaging Het
Adgrl2 G A 3: 148,817,551 L1354F probably damaging Het
Amer2 A G 14: 60,378,551 D65G probably damaging Het
Aox2 G T 1: 58,304,438 V427L possibly damaging Het
Atad2b C A 12: 4,939,689 N133K possibly damaging Het
Bptf A T 11: 107,074,476 D1182E probably damaging Het
Camk1g T C 1: 193,359,807 T45A possibly damaging Het
Caps2 C A 10: 112,182,486 Y180* probably null Het
Cfap54 T A 10: 93,045,278 K349N probably damaging Het
Ciz1 A G 2: 32,370,063 D207G probably benign Het
Copa T A 1: 172,091,233 C127S probably damaging Het
Crabp2 A T 3: 87,952,177 K45* probably null Het
Daam1 C A 12: 71,947,098 T425K unknown Het
Dapk2 T G 9: 66,254,611 V267G probably damaging Het
Disp1 T C 1: 183,087,242 K1205E probably benign Het
Dlg4 G C 11: 70,017,225 R4T probably damaging Het
Fbf1 A G 11: 116,148,220 I743T probably damaging Het
G6pc2 A G 2: 69,220,112 N27S probably damaging Het
Garnl3 A T 2: 33,034,711 N246K probably damaging Het
Gm7337 A C 5: 87,851,557 noncoding transcript Het
Gpr152 A G 19: 4,142,714 T85A probably benign Het
Hnrnpu T C 1: 178,331,125 probably benign Het
Ighv1-81 C G 12: 115,920,329 E101Q probably benign Het
Ipo9 T C 1: 135,409,476 T174A probably benign Het
Myo9a C T 9: 59,832,315 probably benign Het
Nup155 G T 15: 8,148,383 R1083S possibly damaging Het
Olfr1351 C A 10: 79,017,604 T94N probably benign Het
Olfr213 C T 6: 116,540,846 A131V probably damaging Het
Olfr262 T C 19: 12,241,496 H55R probably benign Het
Olfr739 T A 14: 50,425,031 C171S probably damaging Het
Phyh T A 2: 4,937,671 probably benign Het
Pkp4 G T 2: 59,308,105 R233M probably damaging Het
Plcb1 A T 2: 135,335,482 Q578L probably benign Het
Ppil3 A T 1: 58,434,414 N92K probably benign Het
Prokr1 C T 6: 87,588,431 R144H probably damaging Het
Psap T C 10: 60,277,753 L4P possibly damaging Het
Rai14 T C 15: 10,633,164 T47A possibly damaging Het
Rps2 G T 17: 24,720,978 A129S probably benign Het
Sult2a4 T C 7: 13,989,471 T40A probably benign Het
Tacr2 A G 10: 62,265,245 D378G probably benign Het
Topaz1 T C 9: 122,749,381 I452T probably benign Het
Ttn A G 2: 76,833,237 probably benign Het
Vmn2r115 T A 17: 23,357,024 M532K possibly damaging Het
Vmn2r117 A G 17: 23,460,378 L624P probably damaging Het
Vstm5 T G 9: 15,257,298 S53A probably benign Het
Wipf1 C T 2: 73,434,949 E437K probably damaging Het
Wls G T 3: 159,897,436 C162F probably damaging Het
Yeats2 T C 16: 20,193,645 V531A probably damaging Het
Zfp868 A G 8: 69,612,085 S200P probably benign Het
Other mutations in Fen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02991:Fen1 UTSW 19 10200662 missense probably benign
R4245:Fen1 UTSW 19 10200367 missense probably damaging 0.99
R5481:Fen1 UTSW 19 10200658 missense probably damaging 1.00
R5553:Fen1 UTSW 19 10200423 missense probably benign
R5733:Fen1 UTSW 19 10200658 missense possibly damaging 0.86
R5783:Fen1 UTSW 19 10200830 nonsense probably null
R6244:Fen1 UTSW 19 10200687 missense probably damaging 1.00
R6498:Fen1 UTSW 19 10200115 missense probably damaging 0.96
R6797:Fen1 UTSW 19 10200703 missense probably benign 0.37
R7988:Fen1 UTSW 19 10200310 missense possibly damaging 0.94
R8374:Fen1 UTSW 19 10200460 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTGACCCCACTGCGAATTC -3'
(R):5'- TGCGACACTTAACTGCCAGTG -3'

Sequencing Primer
(F):5'- GAATTCGCTCTTCAGAAAACTGC -3'
(R):5'- GCTGCCCATCCAAGAGTTC -3'
Posted On2015-01-23