Incidental Mutation 'R3276:Klhl32'
ID 258201
Institutional Source Beutler Lab
Gene Symbol Klhl32
Ensembl Gene ENSMUSG00000040387
Gene Name kelch-like 32
Synonyms LOC384000, D4Ertd389e, 6430524H05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R3276 (G1)
Quality Score 216
Status Validated
Chromosome 4
Chromosomal Location 24612554-24851124 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 24682063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 207 (I207V)
Ref Sequence ENSEMBL: ENSMUSP00000103853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084781] [ENSMUST00000108214] [ENSMUST00000108218] [ENSMUST00000140652] [ENSMUST00000150920]
AlphaFold A2AJX0
Predicted Effect probably benign
Transcript: ENSMUST00000084781
AA Change: I174V

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000081839
Gene: ENSMUSG00000040387
AA Change: I174V

DomainStartEndE-ValueType
BTB 42 138 1.28e-22 SMART
BACK 111 212 3.17e-22 SMART
Kelch 257 313 4.07e-1 SMART
Kelch 314 365 3.57e-1 SMART
Kelch 366 413 3.77e-4 SMART
Kelch 414 461 7.04e-4 SMART
Kelch 462 514 6.47e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108213
Predicted Effect probably benign
Transcript: ENSMUST00000108214
AA Change: I207V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103849
Gene: ENSMUSG00000040387
AA Change: I207V

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 225 3.31e-2 SMART
Blast:Kelch 233 285 1e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000108218
AA Change: I207V

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103853
Gene: ENSMUSG00000040387
AA Change: I207V

DomainStartEndE-ValueType
BTB 42 139 2.86e-25 SMART
BACK 144 245 3.17e-22 SMART
Kelch 290 346 4.07e-1 SMART
Kelch 347 398 3.57e-1 SMART
Kelch 399 446 3.77e-4 SMART
Kelch 447 494 7.04e-4 SMART
Kelch 495 547 6.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140652
SMART Domains Protein: ENSMUSP00000137312
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
BTB 42 139 2.14e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150920
SMART Domains Protein: ENSMUSP00000135917
Gene: ENSMUSG00000040387

DomainStartEndE-ValueType
Blast:BTB 1 49 4e-19 BLAST
Meta Mutation Damage Score 0.2761 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Golga3 T C 5: 110,201,998 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Nsun6 A G 2: 15,009,404 probably benign Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Ranbp1 T C 16: 18,247,429 probably benign Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Klhl32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Klhl32 APN 4 24682245 missense probably damaging 1.00
IGL02293:Klhl32 APN 4 24626935 missense probably damaging 1.00
IGL02374:Klhl32 APN 4 24743856 critical splice donor site probably null
IGL02824:Klhl32 APN 4 24682237 nonsense probably null
IGL03211:Klhl32 APN 4 24792616 critical splice donor site probably null
IGL03374:Klhl32 APN 4 24649533 intron probably benign
R0071:Klhl32 UTSW 4 24743907 missense probably damaging 0.98
R0478:Klhl32 UTSW 4 24792777 missense probably damaging 1.00
R0856:Klhl32 UTSW 4 24682092 missense probably damaging 1.00
R0908:Klhl32 UTSW 4 24682092 missense probably damaging 1.00
R1882:Klhl32 UTSW 4 24743916 nonsense probably null
R1927:Klhl32 UTSW 4 24617474 missense probably benign 0.00
R2137:Klhl32 UTSW 4 24629275 nonsense probably null
R3176:Klhl32 UTSW 4 24682063 missense probably benign 0.39
R4059:Klhl32 UTSW 4 24792781 missense probably damaging 1.00
R4246:Klhl32 UTSW 4 24800822 missense possibly damaging 0.50
R4597:Klhl32 UTSW 4 24629339 missense probably benign 0.21
R4801:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4802:Klhl32 UTSW 4 24649698 missense possibly damaging 0.82
R4929:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
R5654:Klhl32 UTSW 4 24800805 critical splice donor site probably null
R6039:Klhl32 UTSW 4 24792615 critical splice donor site probably null
R6039:Klhl32 UTSW 4 24792615 critical splice donor site probably null
R6362:Klhl32 UTSW 4 24629195 missense probably null 1.00
R6490:Klhl32 UTSW 4 24711578 intron probably benign
R6948:Klhl32 UTSW 4 24629250 missense probably benign 0.00
R6981:Klhl32 UTSW 4 24709030 missense probably damaging 1.00
R8268:Klhl32 UTSW 4 24800843 start gained probably benign
R8379:Klhl32 UTSW 4 24629194 missense probably damaging 1.00
R8419:Klhl32 UTSW 4 24682203 missense possibly damaging 0.93
R8553:Klhl32 UTSW 4 24629343 missense probably benign 0.01
R9257:Klhl32 UTSW 4 24649608 missense probably benign 0.00
R9460:Klhl32 UTSW 4 24649866 missense probably benign 0.14
R9472:Klhl32 UTSW 4 24629273 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTACCCAGGTTTGAGGAAGC -3'
(R):5'- ATTACTTGGATCTGTACAGACTTGC -3'

Sequencing Primer
(F):5'- AGTAGTGGCCTCATCCCAAGTTG -3'
(R):5'- AGACTTGCTGACCTCTTTCAC -3'
Posted On 2015-01-23