Mutagenetix > Incidental Mutations

Incidental Mutation 'R3276:Golga3'

258208

Institutional Source

Beutler Lab

Gene Symbol

Golga3

Ensembl Gene

ENSMUSG00000029502

Gene Name

golgi autoantigen, golgin subfamily a, 3

Synonyms

repro27, G1-499-14, Mea-2, 5430416E01Rik, Mea2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3276 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110176701-110226470 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 110201998 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031477] [ENSMUST00000112512]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000031477

SMART Domains

Protein: ENSMUSP00000031477
Gene: ENSMUSG00000029502

Domain	Start	End	E-Value	Type
internal_repeat_1	24	49	7.67e-5	PROSPERO
internal_repeat_1	91	116	7.67e-5	PROSPERO
low complexity region	232	245	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
low complexity region	312	321	N/A	INTRINSIC
low complexity region	362	375	N/A	INTRINSIC
low complexity region	422	441	N/A	INTRINSIC
internal_repeat_2	444	484	7.67e-5	PROSPERO
low complexity region	534	548	N/A	INTRINSIC
internal_repeat_2	587	624	7.67e-5	PROSPERO
coiled coil region	656	1379	N/A	INTRINSIC
coiled coil region	1417	1453	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112512

SMART Domains

Protein: ENSMUSP00000108131
Gene: ENSMUSG00000029502

Domain	Start	End	E-Value	Type
internal_repeat_2	3	24	9.29e-5	PROSPERO
low complexity region	192	205	N/A	INTRINSIC
low complexity region	229	248	N/A	INTRINSIC
low complexity region	272	281	N/A	INTRINSIC
low complexity region	322	335	N/A	INTRINSIC
low complexity region	382	401	N/A	INTRINSIC
internal_repeat_1	404	444	4.91e-5	PROSPERO
low complexity region	494	508	N/A	INTRINSIC
internal_repeat_1	547	584	4.91e-5	PROSPERO
low complexity region	705	717	N/A	INTRINSIC
low complexity region	792	809	N/A	INTRINSIC
low complexity region	1105	1117	N/A	INTRINSIC
low complexity region	1220	1228	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
internal_repeat_2	1333	1359	9.29e-5	PROSPERO
coiled coil region	1377	1413	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199123

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.7%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes a member of the golgin family of proteins which are localized to the Golgi. Its encoded protein has been postulated to play a role in nuclear transport and Golgi apparatus localization. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Males homozygous for a hypomorphic transgenic insertional mutation exhibit impaired spermatogenesis involving loss of pachytene spermatocytes and are usually sterile. Male mice homozygous for an ENU-induced mutation exhibit infertility with low sperm concentration, poor motility and abnormal shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	C	T	8: 86,506,866	R1269H	probably damaging	Het
Ace	A	G	11: 105,976,702	E164G	probably null	Het
Als2	A	T	1: 59,170,008	V1464E	possibly damaging	Het
Atox1	A	G	11: 55,450,553	L52P	possibly damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Cdkn3	T	C	14: 46,771,477		probably benign	Het
Col16a1	A	G	4: 130,057,999	K72E	probably damaging	Het
Col6a5	G	A	9: 105,911,107	R1565*	probably null	Het
Col6a6	T	C	9: 105,786,230	H36R	probably benign	Het
Cyp4b1	T	C	4: 115,625,850	N415D	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dhcr24	T	C	4: 106,561,239	F25L	probably benign	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Dhx58	A	G	11: 100,696,979	F584S	probably damaging	Het
Dmbt1	A	G	7: 131,088,071	T715A	probably benign	Het
Eogt	T	A	6: 97,131,394	I229F	probably benign	Het
Ern2	T	C	7: 122,180,964	T164A	possibly damaging	Het
Fam133b	A	T	5: 3,558,522	N84I	probably damaging	Het
Fbxl21	T	A	13: 56,537,122	Y346*	probably null	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Gm11492	T	C	11: 87,567,244	V148A	possibly damaging	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kcnt2	A	G	1: 140,609,639	N1119S	probably benign	Het
Klhl32	T	C	4: 24,682,063	I207V	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lhfpl5	T	C	17: 28,579,946	I143T	possibly damaging	Het
Lrrk1	T	C	7: 66,305,521	K431E	possibly damaging	Het
Mag	C	T	7: 30,901,648		probably null	Het
Maml3	A	T	3: 51,856,930	N204K	possibly damaging	Het
Mrpl19	T	C	6: 81,964,066	S115G	probably damaging	Het
Mthfd1l	G	C	10: 4,148,025	G954A	probably damaging	Het
Mut	A	G	17: 40,958,872		probably null	Het
Myo19	A	G	11: 84,892,175	I172V	probably benign	Het
Naca	T	C	10: 128,040,661		probably benign	Het
Nfatc2	T	C	2: 168,506,994	N638D	possibly damaging	Het
Nsun6	A	G	2: 15,009,404		probably benign	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr584	C	A	7: 103,085,750	D72E	probably damaging	Het
Olfr913	T	A	9: 38,594,643	C141S	probably damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Prcd	A	G	11: 116,659,811	E103G	possibly damaging	Het
Prkx	A	T	X: 77,771,275	F260I	probably damaging	Het
Rad54l2	A	G	9: 106,753,943		probably null	Het
Ranbp1	T	C	16: 18,247,429		probably benign	Het
Rb1cc1	T	A	1: 6,249,366	M1003K	probably benign	Het
Scap	A	T	9: 110,374,025	M256L	probably benign	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Tmem120b	T	A	5: 123,114,104	I146N	probably damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Ube3a	T	A	7: 59,276,519	C348*	probably null	Het
Ubr4	T	A	4: 139,421,855	D1777E	probably benign	Het
Unc79	C	A	12: 103,113,217	D1880E	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Golga3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Golga3	APN	5	110220887	missense	probably damaging	1.00
IGL00594:Golga3	APN	5	110204975	missense	probably benign	0.37
IGL00672:Golga3	APN	5	110212244	missense	probably damaging	1.00
IGL00821:Golga3	APN	5	110204933	missense	possibly damaging	0.74
IGL01015:Golga3	APN	5	110187717	missense	probably benign	0.04
IGL01408:Golga3	APN	5	110217809	critical splice acceptor site	probably null
IGL01651:Golga3	APN	5	110192905	critical splice acceptor site	probably null
IGL02617:Golga3	APN	5	110188746	missense	probably benign	0.26
cles	UTSW	5	110188707	nonsense	probably null
tenta	UTSW	5	110218130	nonsense	probably null
PIT4544001:Golga3	UTSW	5	110188690	missense	possibly damaging	0.94
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0058:Golga3	UTSW	5	110202777	missense	possibly damaging	0.85
R0591:Golga3	UTSW	5	110188743	missense	probably damaging	1.00
R1219:Golga3	UTSW	5	110184349	nonsense	probably null
R1297:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1299:Golga3	UTSW	5	110204843	missense	probably benign	0.04
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1465:Golga3	UTSW	5	110209878	missense	probably damaging	1.00
R1589:Golga3	UTSW	5	110181783	missense	probably damaging	1.00
R1795:Golga3	UTSW	5	110207627	missense	possibly damaging	0.47
R1992:Golga3	UTSW	5	110192973	missense	probably damaging	0.96
R2116:Golga3	UTSW	5	110187395	missense	probably damaging	0.97
R2130:Golga3	UTSW	5	110202939	critical splice donor site	probably null
R2153:Golga3	UTSW	5	110187990	splice site	probably null
R2158:Golga3	UTSW	5	110187361	missense	probably damaging	1.00
R2357:Golga3	UTSW	5	110202648	missense	probably damaging	1.00
R2397:Golga3	UTSW	5	110205877	splice site	probably benign
R2418:Golga3	UTSW	5	110201868	missense	probably damaging	1.00
R2495:Golga3	UTSW	5	110207596	missense	probably damaging	0.99
R2763:Golga3	UTSW	5	110204895	missense	possibly damaging	0.87
R3614:Golga3	UTSW	5	110220908	missense	probably damaging	1.00
R4520:Golga3	UTSW	5	110203751	nonsense	probably null
R5001:Golga3	UTSW	5	110205777	missense	probably damaging	1.00
R5046:Golga3	UTSW	5	110192940	missense	probably damaging	0.99
R5157:Golga3	UTSW	5	110202671	missense	probably benign	0.00
R5191:Golga3	UTSW	5	110184307	intron	probably benign
R5376:Golga3	UTSW	5	110220945	critical splice donor site	probably null
R5399:Golga3	UTSW	5	110205024	missense	probably damaging	0.96
R5407:Golga3	UTSW	5	110201990	nonsense	probably null
R5884:Golga3	UTSW	5	110216895	missense	probably damaging	1.00
R6087:Golga3	UTSW	5	110204946	missense	probably damaging	0.99
R6526:Golga3	UTSW	5	110204895	missense	probably damaging	0.98
R6651:Golga3	UTSW	5	110218130	nonsense	probably null
R7041:Golga3	UTSW	5	110208584	critical splice donor site	probably null
R7057:Golga3	UTSW	5	110188663	missense	probably damaging	1.00
R7078:Golga3	UTSW	5	110193087	missense	probably damaging	0.99
R7114:Golga3	UTSW	5	110202712	missense	probably benign	0.01
R7190:Golga3	UTSW	5	110209855	missense	probably damaging	1.00
R7405:Golga3	UTSW	5	110208446	missense	probably damaging	0.97
R7528:Golga3	UTSW	5	110212232	missense	probably damaging	1.00
R7638:Golga3	UTSW	5	110205828	missense	probably benign
R7760:Golga3	UTSW	5	110205850	missense	probably benign	0.39
R8099:Golga3	UTSW	5	110188707	nonsense	probably null
R8144:Golga3	UTSW	5	110185879	missense	probably damaging	0.99
R8558:Golga3	UTSW	5	110208555	missense	possibly damaging	0.83
R8708:Golga3	UTSW	5	110202855	missense	probably benign	0.05
R8887:Golga3	UTSW	5	110205760	intron	probably benign
R9039:Golga3	UTSW	5	110204933	missense	probably benign	0.00
R9045:Golga3	UTSW	5	110193097	missense	probably benign	0.00
R9057:Golga3	UTSW	5	110184599	missense	probably damaging	1.00
R9100:Golga3	UTSW	5	110189678	missense	probably benign	0.31
R9112:Golga3	UTSW	5	110185891	missense	probably benign	0.08
R9198:Golga3	UTSW	5	110207753	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- GAAACGCTGTTTTCTTATTCAGGCTG -3'
(R):5'- AGCAAACCCATGATCAGGCTG -3'

Sequencing Primer
(F):5'- TCAGGCTGACATGTTAGATCAG -3'
(R):5'- CCATGATCAGGCTGGCAAC -3'

Posted On

2015-01-23