Incidental Mutation 'R3276:Abcc12'
ID258218
Institutional Source Beutler Lab
Gene Symbol Abcc12
Ensembl Gene ENSMUSG00000036872
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 12
Synonyms4930467B22Rik, MRP9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R3276 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location86482260-86580686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86506866 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 1269 (R1269H)
Ref Sequence ENSEMBL: ENSMUSP00000122402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080115] [ENSMUST00000129898] [ENSMUST00000131423] [ENSMUST00000131806] [ENSMUST00000156610]
Predicted Effect probably damaging
Transcript: ENSMUST00000080115
AA Change: R1269H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000079014
Gene: ENSMUSG00000036872
AA Change: R1269H

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 3.6e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 791 1079 1.3e-26 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129898
SMART Domains Protein: ENSMUSP00000122577
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.2e-19 PFAM
AAA 506 679 3.33e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131423
AA Change: R1269H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122402
Gene: ENSMUSG00000036872
AA Change: R1269H

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.1e-21 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Pfam:ABC_membrane 792 1077 1.6e-34 PFAM
AAA 1153 1346 1.07e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131806
SMART Domains Protein: ENSMUSP00000116866
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 1.3e-19 PFAM
AAA 506 679 3.33e-13 SMART
low complexity region 739 752 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156066
SMART Domains Protein: ENSMUSP00000120282
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
Pfam:ABC_membrane 78 363 3.8e-35 PFAM
Pfam:ABC_tran 430 508 5.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156610
SMART Domains Protein: ENSMUSP00000123578
Gene: ENSMUSG00000036872

DomainStartEndE-ValueType
Pfam:ABC_membrane 123 392 5.9e-20 PFAM
AAA 506 661 1.07e-7 SMART
Meta Mutation Damage Score 0.8122 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Golga3 T C 5: 110,201,998 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Nsun6 A G 2: 15,009,404 probably benign Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Ranbp1 T C 16: 18,247,429 probably benign Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Abcc12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Abcc12 APN 8 86534693 missense probably benign 0.45
IGL01504:Abcc12 APN 8 86557602 missense probably damaging 1.00
IGL01593:Abcc12 APN 8 86557650 missense probably damaging 1.00
IGL02164:Abcc12 APN 8 86527404 missense probably damaging 1.00
IGL02173:Abcc12 APN 8 86566442 missense probably damaging 1.00
IGL02175:Abcc12 APN 8 86535013 splice site probably null
IGL02405:Abcc12 APN 8 86558153 missense probably damaging 0.98
IGL02620:Abcc12 APN 8 86505314 splice site probably null
IGL02635:Abcc12 APN 8 86509682 splice site probably benign
IGL03241:Abcc12 APN 8 86509807 missense possibly damaging 0.77
PIT4544001:Abcc12 UTSW 8 86505246 missense possibly damaging 0.58
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0023:Abcc12 UTSW 8 86538333 missense probably damaging 1.00
R0116:Abcc12 UTSW 8 86534998 missense probably benign 0.00
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0131:Abcc12 UTSW 8 86531568 missense probably benign
R0132:Abcc12 UTSW 8 86531568 missense probably benign
R0308:Abcc12 UTSW 8 86557752 splice site probably benign
R0589:Abcc12 UTSW 8 86560472 missense possibly damaging 0.86
R1451:Abcc12 UTSW 8 86557693 missense probably damaging 1.00
R1564:Abcc12 UTSW 8 86517486 missense probably benign 0.10
R1740:Abcc12 UTSW 8 86505497 nonsense probably null
R1740:Abcc12 UTSW 8 86509771 missense possibly damaging 0.78
R1970:Abcc12 UTSW 8 86527281 missense probably benign 0.27
R2017:Abcc12 UTSW 8 86563988 missense probably damaging 1.00
R2026:Abcc12 UTSW 8 86558233 missense probably benign 0.30
R2402:Abcc12 UTSW 8 86509141 missense probably damaging 1.00
R3085:Abcc12 UTSW 8 86543907 splice site probably benign
R3115:Abcc12 UTSW 8 86540024 critical splice donor site probably null
R3176:Abcc12 UTSW 8 86506866 missense probably damaging 1.00
R3847:Abcc12 UTSW 8 86553391 missense probably benign 0.05
R3911:Abcc12 UTSW 8 86528419 splice site probably benign
R4031:Abcc12 UTSW 8 86517448 missense probably damaging 1.00
R4297:Abcc12 UTSW 8 86531525 splice site probably null
R4298:Abcc12 UTSW 8 86531525 splice site probably null
R4299:Abcc12 UTSW 8 86531525 splice site probably null
R4688:Abcc12 UTSW 8 86548694 missense possibly damaging 0.46
R4810:Abcc12 UTSW 8 86560842 missense probably damaging 1.00
R4863:Abcc12 UTSW 8 86538376 missense probably damaging 1.00
R4892:Abcc12 UTSW 8 86509802 missense probably benign 0.28
R5288:Abcc12 UTSW 8 86566539 missense probably damaging 1.00
R5303:Abcc12 UTSW 8 86509786 missense probably benign 0.15
R5332:Abcc12 UTSW 8 86524830 splice site probably null
R5386:Abcc12 UTSW 8 86517489 missense possibly damaging 0.82
R5457:Abcc12 UTSW 8 86509844 missense probably benign 0.03
R5900:Abcc12 UTSW 8 86566520 missense possibly damaging 0.90
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6035:Abcc12 UTSW 8 86517404 missense probably damaging 0.98
R6291:Abcc12 UTSW 8 86566544 missense possibly damaging 0.72
R6518:Abcc12 UTSW 8 86509089
R6677:Abcc12 UTSW 8 86534752 missense possibly damaging 0.58
R7258:Abcc12 UTSW 8 86560857 missense possibly damaging 0.94
R7411:Abcc12 UTSW 8 86560850 missense possibly damaging 0.95
R7619:Abcc12 UTSW 8 86566553 missense probably damaging 1.00
R7808:Abcc12 UTSW 8 86507939 missense probably benign 0.03
R7828:Abcc12 UTSW 8 86528275 missense probably benign 0.08
R7834:Abcc12 UTSW 8 86531550 missense possibly damaging 0.81
R7834:Abcc12 UTSW 8 86558230 missense probably damaging 1.00
R7917:Abcc12 UTSW 8 86531550 missense possibly damaging 0.81
R7917:Abcc12 UTSW 8 86558230 missense probably damaging 1.00
X0027:Abcc12 UTSW 8 86553291 missense probably damaging 0.99
Z1088:Abcc12 UTSW 8 86560279 synonymous probably null
Z1176:Abcc12 UTSW 8 86550601 missense probably damaging 1.00
Z1177:Abcc12 UTSW 8 86527384 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTAAGGGAAAGCGATCGGC -3'
(R):5'- TGCAGGCCATTTCCATTTGC -3'

Sequencing Primer
(F):5'- GCGATCGGCTTTTAAATTACTGCAG -3'
(R):5'- GCAGGCCATTTCCATTTGCTTAAATG -3'
Posted On2015-01-23