Mutagenetix > Incidental Mutations

Incidental Mutation 'R3276:Rad54l2'

258222

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3276 (G1)

Quality Score

187

Status

Validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 106753943 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000046502

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Meta Mutation Damage Score

0.9489

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.7%

Validation Efficiency

96% (47/49)

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	C	T	8: 86,506,866	R1269H	probably damaging	Het
Ace	A	G	11: 105,976,702	E164G	probably null	Het
Als2	A	T	1: 59,170,008	V1464E	possibly damaging	Het
Atox1	A	G	11: 55,450,553	L52P	possibly damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Cdkn3	T	C	14: 46,771,477		probably benign	Het
Col16a1	A	G	4: 130,057,999	K72E	probably damaging	Het
Col6a5	G	A	9: 105,911,107	R1565*	probably null	Het
Col6a6	T	C	9: 105,786,230	H36R	probably benign	Het
Cyp4b1	T	C	4: 115,625,850	N415D	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dhcr24	T	C	4: 106,561,239	F25L	probably benign	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Dhx58	A	G	11: 100,696,979	F584S	probably damaging	Het
Dmbt1	A	G	7: 131,088,071	T715A	probably benign	Het
Eogt	T	A	6: 97,131,394	I229F	probably benign	Het
Ern2	T	C	7: 122,180,964	T164A	possibly damaging	Het
Fam133b	A	T	5: 3,558,522	N84I	probably damaging	Het
Fbxl21	T	A	13: 56,537,122	Y346*	probably null	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Gm11492	T	C	11: 87,567,244	V148A	possibly damaging	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Golga3	T	C	5: 110,201,998		probably benign	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kcnt2	A	G	1: 140,609,639	N1119S	probably benign	Het
Klhl32	T	C	4: 24,682,063	I207V	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lhfpl5	T	C	17: 28,579,946	I143T	possibly damaging	Het
Lrrk1	T	C	7: 66,305,521	K431E	possibly damaging	Het
Mag	C	T	7: 30,901,648		probably null	Het
Maml3	A	T	3: 51,856,930	N204K	possibly damaging	Het
Mrpl19	T	C	6: 81,964,066	S115G	probably damaging	Het
Mthfd1l	G	C	10: 4,148,025	G954A	probably damaging	Het
Mut	A	G	17: 40,958,872		probably null	Het
Myo19	A	G	11: 84,892,175	I172V	probably benign	Het
Naca	T	C	10: 128,040,661		probably benign	Het
Nfatc2	T	C	2: 168,506,994	N638D	possibly damaging	Het
Nsun6	A	G	2: 15,009,404		probably benign	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr584	C	A	7: 103,085,750	D72E	probably damaging	Het
Olfr913	T	A	9: 38,594,643	C141S	probably damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Prcd	A	G	11: 116,659,811	E103G	possibly damaging	Het
Prkx	A	T	X: 77,771,275	F260I	probably damaging	Het
Ranbp1	T	C	16: 18,247,429		probably benign	Het
Rb1cc1	T	A	1: 6,249,366	M1003K	probably benign	Het
Scap	A	T	9: 110,374,025	M256L	probably benign	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Tmem120b	T	A	5: 123,114,104	I146N	probably damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Ube3a	T	A	7: 59,276,519	C348*	probably null	Het
Ubr4	T	A	4: 139,421,855	D1777E	probably benign	Het
Unc79	C	A	12: 103,113,217	D1880E	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0519:Rad54l2	UTSW	9	106708299	missense	probably damaging	0.98
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- GAAGTTCTGTGGCCCTTTCC -3'
(R):5'- ATGCCCACTGAGGACTTCTG -3'

Sequencing Primer
(F):5'- CCTCAGTACTTAGAAAAGTGAGGC -3'
(R):5'- ACTTCTGGGAGCCATGTCAGAC -3'

Posted On

2015-01-23