Mutagenetix > Incidental Mutations

Incidental Mutation 'R3276:Mthfd1l'

258225

Institutional Source

Beutler Lab

Gene Symbol

Mthfd1l

Ensembl Gene

ENSMUSG00000040675

Gene Name

methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like

Synonyms

Fthfsdc1, 2410004L15Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3276 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3973118-4167081 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 4148025 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Alanine at position 954 (G954A)

Ref Sequence

ENSEMBL: ENSMUSP00000112897 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043735] [ENSMUST00000117291] [ENSMUST00000120585]

AlphaFold

Q3V3R1

Predicted Effect

probably damaging
Transcript: ENSMUST00000043735
AA Change: G954A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000036178
Gene: ENSMUSG00000040675
AA Change: G954A

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	30	41	N/A	INTRINSIC
Pfam:THF_DHG_CYH	71	179	2.9e-15	PFAM
Pfam:THF_DHG_CYH_C	182	337	1.1e-27	PFAM
Pfam:FTHFS	358	977	1.2e-260	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117291
AA Change: G954A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112870
Gene: ENSMUSG00000040675
AA Change: G954A

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	30	41	N/A	INTRINSIC
Pfam:THF_DHG_CYH	71	179	2.9e-15	PFAM
Pfam:THF_DHG_CYH_C	182	337	1.1e-27	PFAM
Pfam:FTHFS	358	977	1.2e-260	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000120585
AA Change: G954A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112897
Gene: ENSMUSG00000040675
AA Change: G954A

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
low complexity region	30	41	N/A	INTRINSIC
Pfam:THF_DHG_CYH	70	179	8e-17	PFAM
Pfam:THF_DHG_CYH_C	182	337	5.4e-28	PFAM
Pfam:FTHFS	359	977	7.2e-260	PFAM

Meta Mutation Damage Score

0.9418

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.7%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality, delayed embryonic growth, craniofacial anomalies, and neural tube defects including craniorachischisis, exencephaly and/or a wavy neural tube. Maternal formate supplementation reduces the incidence of NTDs and improves embryonic growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	C	T	8: 86,506,866	R1269H	probably damaging	Het
Ace	A	G	11: 105,976,702	E164G	probably null	Het
Als2	A	T	1: 59,170,008	V1464E	possibly damaging	Het
Atox1	A	G	11: 55,450,553	L52P	possibly damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Cdkn3	T	C	14: 46,771,477		probably benign	Het
Col16a1	A	G	4: 130,057,999	K72E	probably damaging	Het
Col6a5	G	A	9: 105,911,107	R1565*	probably null	Het
Col6a6	T	C	9: 105,786,230	H36R	probably benign	Het
Cyp4b1	T	C	4: 115,625,850	N415D	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dhcr24	T	C	4: 106,561,239	F25L	probably benign	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Dhx58	A	G	11: 100,696,979	F584S	probably damaging	Het
Dmbt1	A	G	7: 131,088,071	T715A	probably benign	Het
Eogt	T	A	6: 97,131,394	I229F	probably benign	Het
Ern2	T	C	7: 122,180,964	T164A	possibly damaging	Het
Fam133b	A	T	5: 3,558,522	N84I	probably damaging	Het
Fbxl21	T	A	13: 56,537,122	Y346*	probably null	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Gm11492	T	C	11: 87,567,244	V148A	possibly damaging	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Golga3	T	C	5: 110,201,998		probably benign	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kcnt2	A	G	1: 140,609,639	N1119S	probably benign	Het
Klhl32	T	C	4: 24,682,063	I207V	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lhfpl5	T	C	17: 28,579,946	I143T	possibly damaging	Het
Lrrk1	T	C	7: 66,305,521	K431E	possibly damaging	Het
Mag	C	T	7: 30,901,648		probably null	Het
Maml3	A	T	3: 51,856,930	N204K	possibly damaging	Het
Mrpl19	T	C	6: 81,964,066	S115G	probably damaging	Het
Mut	A	G	17: 40,958,872		probably null	Het
Myo19	A	G	11: 84,892,175	I172V	probably benign	Het
Naca	T	C	10: 128,040,661		probably benign	Het
Nfatc2	T	C	2: 168,506,994	N638D	possibly damaging	Het
Nsun6	A	G	2: 15,009,404		probably benign	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr584	C	A	7: 103,085,750	D72E	probably damaging	Het
Olfr913	T	A	9: 38,594,643	C141S	probably damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Prcd	A	G	11: 116,659,811	E103G	possibly damaging	Het
Prkx	A	T	X: 77,771,275	F260I	probably damaging	Het
Rad54l2	A	G	9: 106,753,943		probably null	Het
Ranbp1	T	C	16: 18,247,429		probably benign	Het
Rb1cc1	T	A	1: 6,249,366	M1003K	probably benign	Het
Scap	A	T	9: 110,374,025	M256L	probably benign	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Tmem120b	T	A	5: 123,114,104	I146N	probably damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Ube3a	T	A	7: 59,276,519	C348*	probably null	Het
Ubr4	T	A	4: 139,421,855	D1777E	probably benign	Het
Unc79	C	A	12: 103,113,217	D1880E	probably damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Mthfd1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Mthfd1l	APN	10	3989971	synonymous	probably benign
IGL01013:Mthfd1l	APN	10	4030716	missense	probably damaging	1.00
IGL01018:Mthfd1l	APN	10	3978708	missense	probably benign
IGL01018:Mthfd1l	APN	10	4007800	missense	probably benign
IGL01018:Mthfd1l	APN	10	4032345	splice site	probably benign
IGL01068:Mthfd1l	APN	10	4028428	missense	probably damaging	1.00
IGL01584:Mthfd1l	APN	10	4016738	missense	probably damaging	0.97
IGL01609:Mthfd1l	APN	10	4018567	missense	probably benign	0.00
IGL02272:Mthfd1l	APN	10	4041812	missense	probably damaging	0.99
IGL02344:Mthfd1l	APN	10	4048272	splice site	probably null
IGL02429:Mthfd1l	APN	10	4089334	missense	probably damaging	1.00
IGL02503:Mthfd1l	APN	10	4083824	missense	probably damaging	1.00
IGL02748:Mthfd1l	APN	10	4018587	missense	possibly damaging	0.94
IGL02748:Mthfd1l	APN	10	3980268	critical splice donor site	probably null
IGL03031:Mthfd1l	APN	10	4018601	critical splice donor site	probably null
IGL03047:Mthfd1l	APN	10	3980409	splice site	probably benign
IGL03215:Mthfd1l	APN	10	4041826	missense	probably benign	0.14
IGL03367:Mthfd1l	APN	10	4106536	splice site	probably benign
R0047:Mthfd1l	UTSW	10	3978727	splice site	probably benign
R0047:Mthfd1l	UTSW	10	3978727	splice site	probably benign
R0107:Mthfd1l	UTSW	10	4041838	missense	probably benign
R0348:Mthfd1l	UTSW	10	4056766	missense	probably damaging	1.00
R0496:Mthfd1l	UTSW	10	4090006	missense	probably benign
R0658:Mthfd1l	UTSW	10	4047976	splice site	probably null
R1177:Mthfd1l	UTSW	10	3985661	missense	possibly damaging	0.82
R1676:Mthfd1l	UTSW	10	4083877	critical splice donor site	probably null
R1703:Mthfd1l	UTSW	10	4148093	missense	probably damaging	1.00
R1888:Mthfd1l	UTSW	10	4106528	missense	probably damaging	1.00
R1888:Mthfd1l	UTSW	10	4106528	missense	probably damaging	1.00
R1891:Mthfd1l	UTSW	10	4032284	nonsense	probably null
R2014:Mthfd1l	UTSW	10	4047894	missense	probably benign
R2061:Mthfd1l	UTSW	10	4103288	missense	probably benign	0.00
R2197:Mthfd1l	UTSW	10	4028399	missense	probably damaging	1.00
R2360:Mthfd1l	UTSW	10	4056771	missense	probably damaging	1.00
R3085:Mthfd1l	UTSW	10	4090007	missense	probably benign	0.00
R3176:Mthfd1l	UTSW	10	4148025	missense	probably damaging	1.00
R4065:Mthfd1l	UTSW	10	4032242	missense	probably damaging	1.00
R4612:Mthfd1l	UTSW	10	4030717	missense	probably damaging	1.00
R4803:Mthfd1l	UTSW	10	4007840	missense	possibly damaging	0.52
R4883:Mthfd1l	UTSW	10	4007775	missense	probably benign	0.11
R4932:Mthfd1l	UTSW	10	3980241	missense	probably benign	0.00
R5507:Mthfd1l	UTSW	10	4106432	missense	probably benign	0.20
R5687:Mthfd1l	UTSW	10	3990002	splice site	probably null
R5694:Mthfd1l	UTSW	10	4035239	missense	possibly damaging	0.90
R5727:Mthfd1l	UTSW	10	4103302	missense	possibly damaging	0.86
R5908:Mthfd1l	UTSW	10	4089392	missense	probably damaging	1.00
R5951:Mthfd1l	UTSW	10	4048222	missense	probably damaging	1.00
R6330:Mthfd1l	UTSW	10	3980234	missense	probably benign
R6583:Mthfd1l	UTSW	10	4047937	missense	probably damaging	0.96
R6846:Mthfd1l	UTSW	10	4047898	missense	probably damaging	1.00
R7105:Mthfd1l	UTSW	10	4103261	missense	probably benign
R7456:Mthfd1l	UTSW	10	4089998	missense	probably damaging	1.00
R7848:Mthfd1l	UTSW	10	4083739	missense	possibly damaging	0.81
R8003:Mthfd1l	UTSW	10	3984147	missense	probably benign	0.00
R8073:Mthfd1l	UTSW	10	3973417	missense	probably benign	0.28
R8140:Mthfd1l	UTSW	10	4007745	nonsense	probably null
R8478:Mthfd1l	UTSW	10	4148064	missense	probably damaging	1.00
R8677:Mthfd1l	UTSW	10	4048250	missense	possibly damaging	0.58
R8943:Mthfd1l	UTSW	10	4028466	missense	probably damaging	1.00
R9086:Mthfd1l	UTSW	10	3973412	missense	probably benign	0.22
R9267:Mthfd1l	UTSW	10	3984154	missense	probably benign
R9371:Mthfd1l	UTSW	10	4103335	missense	possibly damaging	0.49
X0003:Mthfd1l	UTSW	10	4089303	missense	probably damaging	0.99
Z1088:Mthfd1l	UTSW	10	4007844	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTTTGCAGAGTGTGAAGGCAG -3'
(R):5'- CTGTGTAGTGACCTAGGAACAATTTAC -3'

Sequencing Primer
(F):5'- GCAGGGGGCAAACTGAC -3'
(R):5'- TGTTTGATTGCATTTATAACAAACCC -3'

Posted On

2015-01-23