Incidental Mutation 'R3276:Mthfd1l'
ID 258225
Institutional Source Beutler Lab
Gene Symbol Mthfd1l
Ensembl Gene ENSMUSG00000040675
Gene Name methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1-like
Synonyms Fthfsdc1, 2410004L15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R3276 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 3973118-4167081 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 4148025 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Alanine at position 954 (G954A)
Ref Sequence ENSEMBL: ENSMUSP00000112897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043735] [ENSMUST00000117291] [ENSMUST00000120585]
AlphaFold Q3V3R1
Predicted Effect probably damaging
Transcript: ENSMUST00000043735
AA Change: G954A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036178
Gene: ENSMUSG00000040675
AA Change: G954A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117291
AA Change: G954A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112870
Gene: ENSMUSG00000040675
AA Change: G954A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 71 179 2.9e-15 PFAM
Pfam:THF_DHG_CYH_C 182 337 1.1e-27 PFAM
Pfam:FTHFS 358 977 1.2e-260 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120585
AA Change: G954A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112897
Gene: ENSMUSG00000040675
AA Change: G954A

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 30 41 N/A INTRINSIC
Pfam:THF_DHG_CYH 70 179 8e-17 PFAM
Pfam:THF_DHG_CYH_C 182 337 5.4e-28 PFAM
Pfam:FTHFS 359 977 7.2e-260 PFAM
Meta Mutation Damage Score 0.9418 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of tetrahydrofolate (THF) in the mitochondrion. THF is important in the de novo synthesis of purines and thymidylate and in the regeneration of methionine from homocysteine. Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality, delayed embryonic growth, craniofacial anomalies, and neural tube defects including craniorachischisis, exencephaly and/or a wavy neural tube. Maternal formate supplementation reduces the incidence of NTDs and improves embryonic growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Golga3 T C 5: 110,201,998 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Nsun6 A G 2: 15,009,404 probably benign Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Ranbp1 T C 16: 18,247,429 probably benign Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Mthfd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Mthfd1l APN 10 3989971 synonymous probably benign
IGL01013:Mthfd1l APN 10 4030716 missense probably damaging 1.00
IGL01018:Mthfd1l APN 10 3978708 missense probably benign
IGL01018:Mthfd1l APN 10 4007800 missense probably benign
IGL01018:Mthfd1l APN 10 4032345 splice site probably benign
IGL01068:Mthfd1l APN 10 4028428 missense probably damaging 1.00
IGL01584:Mthfd1l APN 10 4016738 missense probably damaging 0.97
IGL01609:Mthfd1l APN 10 4018567 missense probably benign 0.00
IGL02272:Mthfd1l APN 10 4041812 missense probably damaging 0.99
IGL02344:Mthfd1l APN 10 4048272 splice site probably null
IGL02429:Mthfd1l APN 10 4089334 missense probably damaging 1.00
IGL02503:Mthfd1l APN 10 4083824 missense probably damaging 1.00
IGL02748:Mthfd1l APN 10 4018587 missense possibly damaging 0.94
IGL02748:Mthfd1l APN 10 3980268 critical splice donor site probably null
IGL03031:Mthfd1l APN 10 4018601 critical splice donor site probably null
IGL03047:Mthfd1l APN 10 3980409 splice site probably benign
IGL03215:Mthfd1l APN 10 4041826 missense probably benign 0.14
IGL03367:Mthfd1l APN 10 4106536 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0047:Mthfd1l UTSW 10 3978727 splice site probably benign
R0107:Mthfd1l UTSW 10 4041838 missense probably benign
R0348:Mthfd1l UTSW 10 4056766 missense probably damaging 1.00
R0496:Mthfd1l UTSW 10 4090006 missense probably benign
R0658:Mthfd1l UTSW 10 4047976 splice site probably null
R1177:Mthfd1l UTSW 10 3985661 missense possibly damaging 0.82
R1676:Mthfd1l UTSW 10 4083877 critical splice donor site probably null
R1703:Mthfd1l UTSW 10 4148093 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1888:Mthfd1l UTSW 10 4106528 missense probably damaging 1.00
R1891:Mthfd1l UTSW 10 4032284 nonsense probably null
R2014:Mthfd1l UTSW 10 4047894 missense probably benign
R2061:Mthfd1l UTSW 10 4103288 missense probably benign 0.00
R2197:Mthfd1l UTSW 10 4028399 missense probably damaging 1.00
R2360:Mthfd1l UTSW 10 4056771 missense probably damaging 1.00
R3085:Mthfd1l UTSW 10 4090007 missense probably benign 0.00
R3176:Mthfd1l UTSW 10 4148025 missense probably damaging 1.00
R4065:Mthfd1l UTSW 10 4032242 missense probably damaging 1.00
R4612:Mthfd1l UTSW 10 4030717 missense probably damaging 1.00
R4803:Mthfd1l UTSW 10 4007840 missense possibly damaging 0.52
R4883:Mthfd1l UTSW 10 4007775 missense probably benign 0.11
R4932:Mthfd1l UTSW 10 3980241 missense probably benign 0.00
R5507:Mthfd1l UTSW 10 4106432 missense probably benign 0.20
R5687:Mthfd1l UTSW 10 3990002 splice site probably null
R5694:Mthfd1l UTSW 10 4035239 missense possibly damaging 0.90
R5727:Mthfd1l UTSW 10 4103302 missense possibly damaging 0.86
R5908:Mthfd1l UTSW 10 4089392 missense probably damaging 1.00
R5951:Mthfd1l UTSW 10 4048222 missense probably damaging 1.00
R6330:Mthfd1l UTSW 10 3980234 missense probably benign
R6583:Mthfd1l UTSW 10 4047937 missense probably damaging 0.96
R6846:Mthfd1l UTSW 10 4047898 missense probably damaging 1.00
R7105:Mthfd1l UTSW 10 4103261 missense probably benign
R7456:Mthfd1l UTSW 10 4089998 missense probably damaging 1.00
R7848:Mthfd1l UTSW 10 4083739 missense possibly damaging 0.81
R8003:Mthfd1l UTSW 10 3984147 missense probably benign 0.00
R8073:Mthfd1l UTSW 10 3973417 missense probably benign 0.28
R8140:Mthfd1l UTSW 10 4007745 nonsense probably null
R8478:Mthfd1l UTSW 10 4148064 missense probably damaging 1.00
R8677:Mthfd1l UTSW 10 4048250 missense possibly damaging 0.58
R8943:Mthfd1l UTSW 10 4028466 missense probably damaging 1.00
R9086:Mthfd1l UTSW 10 3973412 missense probably benign 0.22
R9267:Mthfd1l UTSW 10 3984154 missense probably benign
R9371:Mthfd1l UTSW 10 4103335 missense possibly damaging 0.49
X0003:Mthfd1l UTSW 10 4089303 missense probably damaging 0.99
Z1088:Mthfd1l UTSW 10 4007844 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTGCAGAGTGTGAAGGCAG -3'
(R):5'- CTGTGTAGTGACCTAGGAACAATTTAC -3'

Sequencing Primer
(F):5'- GCAGGGGGCAAACTGAC -3'
(R):5'- TGTTTGATTGCATTTATAACAAACCC -3'
Posted On 2015-01-23