Incidental Mutation 'R3276:Naca'
ID258227
Institutional Source Beutler Lab
Gene Symbol Naca
Ensembl Gene ENSMUSG00000061315
Gene Namenascent polypeptide-associated complex alpha polypeptide
SynonymsLOC380777, skNAC
Accession Numbers

Genbank: NM_013608; MGI: 106095 ; Ensembl: ENSMUST00000092048

Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R3276 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128035575-128048637 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 128040661 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000073532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073868] [ENSMUST00000092048]
Predicted Effect probably benign
Transcript: ENSMUST00000073868
SMART Domains Protein: ENSMUSP00000073532
Gene: ENSMUSG00000061315

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:NAC 73 130 3.9e-27 PFAM
low complexity region 157 178 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000092048
AA Change: S521P
SMART Domains Protein: ENSMUSP00000089680
Gene: ENSMUSG00000061315
AA Change: S521P

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
low complexity region 128 142 N/A INTRINSIC
low complexity region 516 533 N/A INTRINSIC
low complexity region 704 718 N/A INTRINSIC
low complexity region 937 954 N/A INTRINSIC
low complexity region 976 998 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1349 1370 N/A INTRINSIC
low complexity region 1489 1504 N/A INTRINSIC
low complexity region 1572 1593 N/A INTRINSIC
low complexity region 1636 1670 N/A INTRINSIC
low complexity region 1714 1727 N/A INTRINSIC
low complexity region 1806 1827 N/A INTRINSIC
low complexity region 1889 1926 N/A INTRINSIC
low complexity region 1943 1957 N/A INTRINSIC
low complexity region 1972 1986 N/A INTRINSIC
low complexity region 2016 2029 N/A INTRINSIC
Pfam:NAC 2045 2101 1.7e-25 PFAM
low complexity region 2129 2150 N/A INTRINSIC
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). This complex binds to nascent proteins that lack a signal peptide motif as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. This protein is an IgE autoantigen in atopic dermatitis patients. Alternative splicing results in multiple transcript variants, but the full length nature of some of these variants, including those encoding very large proteins, has not been determined. There are multiple pseudogenes of this gene on different chromosomes. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a point mutation exhibit decreased bone volume and bone formation associated with accelerated mineralization and immature woven-bone formation. Mice null for the muscle specific isoform die during organogenesis with cardiac abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(156) : Targeted, other(1) Gene trapped(155)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Cdkn3 T C 14: 46,771,477 probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Golga3 T C 5: 110,201,998 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Nsun6 A G 2: 15,009,404 probably benign Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Ranbp1 T C 16: 18,247,429 probably benign Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Naca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Naca APN 10 128041682 intron probably benign
IGL00990:Naca APN 10 128043800 intron probably benign
IGL01093:Naca APN 10 128048113 missense probably damaging 0.99
IGL01356:Naca APN 10 128041715 intron probably benign
IGL01548:Naca APN 10 128040904 intron probably benign
IGL02089:Naca APN 10 128036489 splice site probably benign
IGL02148:Naca APN 10 128043884 intron probably benign
IGL02494:Naca APN 10 128041310 intron probably benign
IGL02672:Naca APN 10 128040283 intron probably benign
IGL02822:Naca APN 10 128039345 intron probably benign
IGL02904:Naca APN 10 128043290 intron probably benign
IGL02931:Naca APN 10 128047682 missense probably damaging 1.00
IGL02971:Naca APN 10 128041568 intron probably benign
IGL03104:Naca APN 10 128040364 intron probably benign
Sinewy UTSW 10 128048358 missense probably damaging 1.00
D4216:Naca UTSW 10 128044240 missense possibly damaging 0.73
P0042:Naca UTSW 10 128041553 intron probably benign
R0110:Naca UTSW 10 128044790 missense probably benign 0.13
R0220:Naca UTSW 10 128043386 intron probably benign
R0469:Naca UTSW 10 128044790 missense probably benign 0.13
R0528:Naca UTSW 10 128043293 missense probably benign 0.23
R0594:Naca UTSW 10 128040355 intron probably benign
R0626:Naca UTSW 10 128041162 intron probably benign
R0885:Naca UTSW 10 128040179 nonsense probably null
R1129:Naca UTSW 10 128040202 intron probably benign
R1437:Naca UTSW 10 128042179 intron probably benign
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1464:Naca UTSW 10 128048288 missense probably damaging 0.96
R1509:Naca UTSW 10 128043397 intron probably benign
R1561:Naca UTSW 10 128040398 intron probably benign
R1574:Naca UTSW 10 128040398 intron probably benign
R1678:Naca UTSW 10 128043526 intron probably benign
R1901:Naca UTSW 10 128043721 intron probably benign
R2884:Naca UTSW 10 128041678 intron probably benign
R2886:Naca UTSW 10 128041678 intron probably benign
R3176:Naca UTSW 10 128040661 intron probably benign
R4227:Naca UTSW 10 128041661 intron probably benign
R4388:Naca UTSW 10 128044792 missense probably damaging 0.99
R4402:Naca UTSW 10 128043472 intron probably benign
R4798:Naca UTSW 10 128047803 missense probably null 0.99
R4955:Naca UTSW 10 128042215 intron probably benign
R4996:Naca UTSW 10 128042429 intron probably benign
R5027:Naca UTSW 10 128048121 missense possibly damaging 0.63
R5580:Naca UTSW 10 128040593 intron probably benign
R5752:Naca UTSW 10 128041928 intron probably benign
R5788:Naca UTSW 10 128040142 intron probably benign
R6156:Naca UTSW 10 128039291 intron probably benign
R6227:Naca UTSW 10 128043916 intron probably benign
R6317:Naca UTSW 10 128044124 missense probably benign 0.33
R6665:Naca UTSW 10 128048358 missense probably damaging 1.00
R7170:Naca UTSW 10 128040121 missense unknown
R7247:Naca UTSW 10 128042598 missense unknown
X0053:Naca UTSW 10 128048255 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAAAGACCCAGCTTCCCCTG -3'
(R):5'- GCTGACACAAGAATCTGCCC -3'

Sequencing Primer
(F):5'- GTCGTACCTGCTGCTCACAAG -3'
(R):5'- GAATCTGCCCTGATGACAGCAG -3'
Posted On2015-01-23