Incidental Mutation 'R3276:Pafah1b1'
ID 258229
Institutional Source Beutler Lab
Gene Symbol Pafah1b1
Ensembl Gene ENSMUSG00000020745
Gene Name platelet-activating factor acetylhydrolase, isoform 1b, subunit 1
Synonyms Pafaha, lissencephaly-1 protein, Mdsh, PAF-AH 45, LIS-1, Lis1
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3276 (G1)
Quality Score 191
Status Validated
Chromosome 11
Chromosomal Location 74673949-74724670 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 74690232 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 57 (S57F)
Ref Sequence ENSEMBL: ENSMUSP00000118231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021091] [ENSMUST00000102520] [ENSMUST00000155493]
AlphaFold P63005
Predicted Effect probably damaging
Transcript: ENSMUST00000021091
AA Change: S57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021091
Gene: ENSMUSG00000020745
AA Change: S57F

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102520
AA Change: S57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099578
Gene: ENSMUSG00000020745
AA Change: S57F

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
WD40 97 136 2.1e-7 SMART
WD40 139 178 9.73e-12 SMART
WD40 181 220 1.1e-10 SMART
WD40 223 262 9.3e-9 SMART
WD40 265 324 4.65e-9 SMART
WD40 327 366 4.11e-10 SMART
WD40 369 408 8.81e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126341
Predicted Effect probably damaging
Transcript: ENSMUST00000155493
AA Change: S57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118231
Gene: ENSMUSG00000020745
AA Change: S57F

DomainStartEndE-ValueType
LisH 7 39 6.12e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156794
Meta Mutation Damage Score 0.6039 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus was identified as encoding a gene that when mutated or lost caused the lissencephaly associated with Miller-Dieker lissencephaly syndrome. This gene encodes the non-catalytic alpha subunit of the intracellular Ib isoform of platelet-activating factor acteylhydrolase, a heterotrimeric enzyme that specifically catalyzes the removal of the acetyl group at the SN-2 position of platelet-activating factor (identified as 1-O-alkyl-2-acetyl-sn-glyceryl-3-phosphorylcholine). Two other isoforms of intracellular platelet-activating factor acetylhydrolase exist: one composed of multiple subunits, the other, a single subunit. In addition, a single-subunit isoform of this enzyme is found in serum. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mutations at this locus result in neuronal migration defects. Homozygous null mutants die around implantation. Different allelic combinations show variable cortical, hippocampal and olfactory disorganization and impaired spatial learning and coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 (GRCm38) R1269H probably damaging Het
Ace A G 11: 105,976,702 (GRCm38) E164G probably null Het
Als2 A T 1: 59,170,008 (GRCm38) V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 (GRCm38) L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 (GRCm38) K282E probably benign Het
Cdkn3 T C 14: 46,771,477 (GRCm38) probably benign Het
Col16a1 A G 4: 130,057,999 (GRCm38) K72E probably damaging Het
Col6a5 G A 9: 105,911,107 (GRCm38) R1565* probably null Het
Col6a6 T C 9: 105,786,230 (GRCm38) H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 (GRCm38) N415D possibly damaging Het
Dennd4a G T 9: 64,888,993 (GRCm38) R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 (GRCm38) F25L probably benign Het
Dhrs3 A G 4: 144,923,940 (GRCm38) T219A probably benign Het
Dhx58 A G 11: 100,696,979 (GRCm38) F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 (GRCm38) T715A probably benign Het
Eogt T A 6: 97,131,394 (GRCm38) I229F probably benign Het
Ern2 T C 7: 122,180,964 (GRCm38) T164A possibly damaging Het
Fam133b A T 5: 3,558,522 (GRCm38) N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 (GRCm38) Y346* probably null Het
Fcgbp C A 7: 28,091,661 (GRCm38) H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 (GRCm38) V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 (GRCm38) E362G probably benign Het
Golga3 T C 5: 110,201,998 (GRCm38) probably benign Het
Gpatch2l A G 12: 86,244,315 (GRCm38) T91A possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 (GRCm38) probably null Het
Hsp90aa1 T A 12: 110,695,680 (GRCm38) M1L possibly damaging Het
Itgad C A 7: 128,190,981 (GRCm38) H651N possibly damaging Het
Itgav A G 2: 83,776,542 (GRCm38) D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 (GRCm38) N1119S probably benign Het
Klhl32 T C 4: 24,682,063 (GRCm38) I207V probably benign Het
Klk14 G A 7: 43,692,077 (GRCm38) C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 (GRCm38) I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 (GRCm38) K431E possibly damaging Het
Mag C T 7: 30,901,648 (GRCm38) probably null Het
Maml3 A T 3: 51,856,930 (GRCm38) N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 (GRCm38) S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 (GRCm38) G954A probably damaging Het
Mut A G 17: 40,958,872 (GRCm38) probably null Het
Myo19 A G 11: 84,892,175 (GRCm38) I172V probably benign Het
Naca T C 10: 128,040,661 (GRCm38) probably benign Het
Nfatc2 T C 2: 168,506,994 (GRCm38) N638D possibly damaging Het
Nsun6 A G 2: 15,009,404 (GRCm38) probably benign Het
Olfr1412 A G 1: 92,588,813 (GRCm38) N161S probably benign Het
Olfr584 C A 7: 103,085,750 (GRCm38) D72E probably damaging Het
Olfr913 T A 9: 38,594,643 (GRCm38) C141S probably damaging Het
Padi6 A G 4: 140,735,389 (GRCm38) L307P probably damaging Het
Prcd A G 11: 116,659,811 (GRCm38) E103G possibly damaging Het
Prkx A T X: 77,771,275 (GRCm38) F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 (GRCm38) probably null Het
Ranbp1 T C 16: 18,247,429 (GRCm38) probably benign Het
Rb1cc1 T A 1: 6,249,366 (GRCm38) M1003K probably benign Het
Scap A T 9: 110,374,025 (GRCm38) M256L probably benign Het
Sema4c C T 1: 36,549,879 (GRCm38) R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 (GRCm38) R171W probably damaging Het
Spata7 A G 12: 98,637,598 (GRCm38) N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 (GRCm38) I146N probably damaging Het
Ttc23l A G 15: 10,547,232 (GRCm38) F99L possibly damaging Het
Ube3a T A 7: 59,276,519 (GRCm38) C348* probably null Het
Ubr4 T A 4: 139,421,855 (GRCm38) D1777E probably benign Het
Unc79 C A 12: 103,113,217 (GRCm38) D1880E probably damaging Het
Usp36 C T 11: 118,276,759 (GRCm38) probably null Het
Zswim9 T C 7: 13,277,270 (GRCm38) T51A possibly damaging Het
Other mutations in Pafah1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Pafah1b1 APN 11 74,683,647 (GRCm38) missense probably damaging 1.00
IGL01861:Pafah1b1 APN 11 74,690,577 (GRCm38) missense possibly damaging 0.81
IGL02082:Pafah1b1 APN 11 74,699,333 (GRCm38) missense probably benign 0.33
IGL03180:Pafah1b1 APN 11 74,683,518 (GRCm38) missense possibly damaging 0.80
hotspur UTSW 11 74,682,272 (GRCm38) missense probably benign 0.02
picador UTSW 11 74,677,731 (GRCm38) missense probably benign
R0362:Pafah1b1 UTSW 11 74,683,631 (GRCm38) missense probably benign 0.01
R0462:Pafah1b1 UTSW 11 74,677,715 (GRCm38) missense probably benign 0.00
R1962:Pafah1b1 UTSW 11 74,699,351 (GRCm38) start gained probably benign
R3176:Pafah1b1 UTSW 11 74,690,232 (GRCm38) missense probably damaging 1.00
R3615:Pafah1b1 UTSW 11 74,690,232 (GRCm38) missense probably damaging 1.00
R3616:Pafah1b1 UTSW 11 74,690,232 (GRCm38) missense probably damaging 1.00
R4326:Pafah1b1 UTSW 11 74,682,240 (GRCm38) missense probably benign 0.04
R4327:Pafah1b1 UTSW 11 74,682,240 (GRCm38) missense probably benign 0.04
R4328:Pafah1b1 UTSW 11 74,682,240 (GRCm38) missense probably benign 0.04
R4776:Pafah1b1 UTSW 11 74,685,871 (GRCm38) unclassified probably benign
R4985:Pafah1b1 UTSW 11 74,685,988 (GRCm38) missense probably damaging 1.00
R5128:Pafah1b1 UTSW 11 74,679,436 (GRCm38) intron probably benign
R5148:Pafah1b1 UTSW 11 74,684,452 (GRCm38) missense probably damaging 0.99
R6406:Pafah1b1 UTSW 11 74,682,272 (GRCm38) missense probably benign 0.02
R6437:Pafah1b1 UTSW 11 74,677,731 (GRCm38) missense probably benign
R7229:Pafah1b1 UTSW 11 74,682,278 (GRCm38) missense probably damaging 0.99
R7480:Pafah1b1 UTSW 11 74,685,914 (GRCm38) missense probably damaging 1.00
R8115:Pafah1b1 UTSW 11 74,684,493 (GRCm38) missense probably damaging 1.00
R9042:Pafah1b1 UTSW 11 74,683,667 (GRCm38) missense probably benign 0.27
X0064:Pafah1b1 UTSW 11 74,689,183 (GRCm38) missense possibly damaging 0.62
Z1176:Pafah1b1 UTSW 11 74,690,241 (GRCm38) missense probably damaging 1.00
Z1176:Pafah1b1 UTSW 11 74,689,119 (GRCm38) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCAGTATAACCTATGTGCACC -3'
(R):5'- GTAGTTAGGTCAATTCAGCTATTCG -3'

Sequencing Primer
(F):5'- TAACCTATGTGCACCAATAATGAAC -3'
(R):5'- GATGTCATGGTTAAGCCAT -3'
Posted On 2015-01-23