Mutagenetix > Incidental Mutation

Incidental Mutation 'R3276:Usp36'

258232

Institutional Source

Beutler Lab

Gene Symbol

Usp36

Ensembl Gene

ENSMUSG00000033909

Gene Name

ubiquitin specific peptidase 36

Synonyms

2700002L06Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.961) question?

Stock #

R3276 (G1)

Quality Score

173

Status

Validated

Chromosome

Chromosomal Location

118259651-118290244 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 118276759 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092382] [ENSMUST00000092382] [ENSMUST00000106296] [ENSMUST00000106296] [ENSMUST00000144153] [ENSMUST00000144153]

AlphaFold

B1AQJ2

Predicted Effect

probably null
Transcript: ENSMUST00000092382

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000092382

SMART Domains

Protein: ENSMUSP00000090036
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.6e-55	PFAM
Pfam:UCH_1	122	402	3.6e-26	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106296

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106296

SMART Domains

Protein: ENSMUSP00000101903
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Blast:NTR	1	29	3e-7	BLAST
Pfam:UCH	121	420	2.1e-49	PFAM
Pfam:UCH_1	122	402	2.2e-23	PFAM
low complexity region	540	558	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC
low complexity region	678	693	N/A	INTRINSIC
low complexity region	744	763	N/A	INTRINSIC
low complexity region	830	839	N/A	INTRINSIC
low complexity region	889	899	N/A	INTRINSIC
low complexity region	933	943	N/A	INTRINSIC
low complexity region	1055	1071	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000144153

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000144153

SMART Domains

Protein: ENSMUSP00000122761
Gene: ENSMUSG00000033909

Domain	Start	End	E-Value	Type
Pfam:UCH	1	255	1e-40	PFAM
Pfam:UCH_1	4	237	2.9e-17	PFAM
low complexity region	375	393	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	513	528	N/A	INTRINSIC
low complexity region	579	598	N/A	INTRINSIC
low complexity region	665	674	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	768	778	N/A	INTRINSIC

Meta Mutation Damage Score

0.9598

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.7%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase C19 or ubiquitin-specific protease family of cysteine proteases. Members of this family remove ubiquitin molecules from polyubiquitinated proteins. The encoded protein may deubiquitinate and stabilize the transcription factor c-Myc, also known as MYC, an important oncoprotein known to be upregulated in most human cancers. The encoded protease may also regulate the activation of autophagy. This gene exhibits elevated expression in some breast and lung cancers. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a gene trap allele display lethality before implantation and arrest at the morula stage. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc12	C	T	8: 86,506,866	R1269H	probably damaging	Het
Ace	A	G	11: 105,976,702	E164G	probably null	Het
Als2	A	T	1: 59,170,008	V1464E	possibly damaging	Het
Atox1	A	G	11: 55,450,553	L52P	possibly damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Cdkn3	T	C	14: 46,771,477		probably benign	Het
Col16a1	A	G	4: 130,057,999	K72E	probably damaging	Het
Col6a5	G	A	9: 105,911,107	R1565*	probably null	Het
Col6a6	T	C	9: 105,786,230	H36R	probably benign	Het
Cyp4b1	T	C	4: 115,625,850	N415D	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dhcr24	T	C	4: 106,561,239	F25L	probably benign	Het
Dhrs3	A	G	4: 144,923,940	T219A	probably benign	Het
Dhx58	A	G	11: 100,696,979	F584S	probably damaging	Het
Dmbt1	A	G	7: 131,088,071	T715A	probably benign	Het
Eogt	T	A	6: 97,131,394	I229F	probably benign	Het
Ern2	T	C	7: 122,180,964	T164A	possibly damaging	Het
Fam133b	A	T	5: 3,558,522	N84I	probably damaging	Het
Fbxl21	T	A	13: 56,537,122	Y346*	probably null	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Gm11492	T	C	11: 87,567,244	V148A	possibly damaging	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Golga3	T	C	5: 110,201,998		probably benign	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kcnt2	A	G	1: 140,609,639	N1119S	probably benign	Het
Klhl32	T	C	4: 24,682,063	I207V	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lhfpl5	T	C	17: 28,579,946	I143T	possibly damaging	Het
Lrrk1	T	C	7: 66,305,521	K431E	possibly damaging	Het
Mag	C	T	7: 30,901,648		probably null	Het
Maml3	A	T	3: 51,856,930	N204K	possibly damaging	Het
Mrpl19	T	C	6: 81,964,066	S115G	probably damaging	Het
Mthfd1l	G	C	10: 4,148,025	G954A	probably damaging	Het
Mut	A	G	17: 40,958,872		probably null	Het
Myo19	A	G	11: 84,892,175	I172V	probably benign	Het
Naca	T	C	10: 128,040,661		probably benign	Het
Nfatc2	T	C	2: 168,506,994	N638D	possibly damaging	Het
Nsun6	A	G	2: 15,009,404		probably benign	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr584	C	A	7: 103,085,750	D72E	probably damaging	Het
Olfr913	T	A	9: 38,594,643	C141S	probably damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Pafah1b1	G	A	11: 74,690,232	S57F	probably damaging	Het
Prcd	A	G	11: 116,659,811	E103G	possibly damaging	Het
Prkx	A	T	X: 77,771,275	F260I	probably damaging	Het
Rad54l2	A	G	9: 106,753,943		probably null	Het
Ranbp1	T	C	16: 18,247,429		probably benign	Het
Rb1cc1	T	A	1: 6,249,366	M1003K	probably benign	Het
Scap	A	T	9: 110,374,025	M256L	probably benign	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Tmem120b	T	A	5: 123,114,104	I146N	probably damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Ube3a	T	A	7: 59,276,519	C348*	probably null	Het
Ubr4	T	A	4: 139,421,855	D1777E	probably benign	Het
Unc79	C	A	12: 103,113,217	D1880E	probably damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Usp36

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Usp36	APN	11	118264820	missense	possibly damaging	0.76
IGL01115:Usp36	APN	11	118285960	missense	probably damaging	1.00
IGL01720:Usp36	APN	11	118275002	missense	probably damaging	0.99
IGL02410:Usp36	APN	11	118276185	missense	probably damaging	1.00
IGL02700:Usp36	APN	11	118276157	missense	possibly damaging	0.95
IGL02926:Usp36	APN	11	118264783	missense	probably benign	0.22
IGL03145:Usp36	APN	11	118279241	missense	probably damaging	1.00
IGL03203:Usp36	APN	11	118285810	missense	probably benign	0.42
IGL03265:Usp36	APN	11	118264809	missense	possibly damaging	0.65
R0482:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R0499:Usp36	UTSW	11	118273571	missense	probably damaging	0.98
R0606:Usp36	UTSW	11	118263028	splice site	probably benign
R0646:Usp36	UTSW	11	118273021	missense	probably damaging	1.00
R1579:Usp36	UTSW	11	118284945	missense	probably damaging	1.00
R1646:Usp36	UTSW	11	118273566	missense	probably damaging	1.00
R1716:Usp36	UTSW	11	118272131	critical splice donor site	probably null
R1886:Usp36	UTSW	11	118272958	missense	probably damaging	1.00
R2014:Usp36	UTSW	11	118262508	splice site	probably benign
R2068:Usp36	UTSW	11	118275018	missense	possibly damaging	0.80
R2146:Usp36	UTSW	11	118268665	missense	probably benign	0.02
R2191:Usp36	UTSW	11	118285023	missense	possibly damaging	0.95
R2899:Usp36	UTSW	11	118276756	splice site	probably benign
R3176:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3177:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3277:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3615:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3616:Usp36	UTSW	11	118276759	critical splice donor site	probably null
R3768:Usp36	UTSW	11	118263052	missense	probably damaging	1.00
R3899:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R3900:Usp36	UTSW	11	118279824	missense	possibly damaging	0.90
R4484:Usp36	UTSW	11	118285795	missense	probably damaging	0.99
R4809:Usp36	UTSW	11	118263070	missense	probably damaging	1.00
R5135:Usp36	UTSW	11	118264905	missense	possibly damaging	0.58
R5323:Usp36	UTSW	11	118265194	missense	probably benign	0.21
R6226:Usp36	UTSW	11	118277274	missense	probably damaging	1.00
R6266:Usp36	UTSW	11	118268585	missense	probably damaging	1.00
R7191:Usp36	UTSW	11	118268834	missense	probably benign	0.39
R7215:Usp36	UTSW	11	118265154	missense	possibly damaging	0.87
R7289:Usp36	UTSW	11	118273529	missense	probably damaging	1.00
R7535:Usp36	UTSW	11	118262046	missense	possibly damaging	0.92
R7675:Usp36	UTSW	11	118263696	missense	probably benign	0.11
R7843:Usp36	UTSW	11	118285965	missense	probably damaging	1.00
R8228:Usp36	UTSW	11	118264890	missense	possibly damaging	0.77
R8902:Usp36	UTSW	11	118275014	missense	probably damaging	1.00
R8935:Usp36	UTSW	11	118276831	critical splice acceptor site	probably null
R8995:Usp36	UTSW	11	118284999	missense	probably damaging	1.00
R9024:Usp36	UTSW	11	118276157	missense	possibly damaging	0.95
R9325:Usp36	UTSW	11	118269205	missense	possibly damaging	0.69
R9529:Usp36	UTSW	11	118268635	nonsense	probably null
R9774:Usp36	UTSW	11	118263049	missense	probably damaging	1.00
X0020:Usp36	UTSW	11	118273613	missense	probably damaging	1.00
Z1177:Usp36	UTSW	11	118276200	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCATAGGAGAACTGCAGAC -3'
(R):5'- ATGACAGAACCTGGCCTCAC -3'

Sequencing Primer
(F):5'- ACAGATGCAAATGTTGGCCTGTC -3'
(R):5'- AGAACCTGGCCTCACCTGTATC -3'

Posted On

2015-01-23