Incidental Mutation 'R3276:Cdkn3'
ID258239
Institutional Source Beutler Lab
Gene Symbol Cdkn3
Ensembl Gene ENSMUSG00000037628
Gene Namecyclin-dependent kinase inhibitor 3
Synonyms2410006H10Rik, KAP
Accession Numbers

Ncbi RefSeq: NM_028222.1; MGI:1919641

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3276 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location46760541-46771669 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 46771477 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015903] [ENSMUST00000067426] [ENSMUST00000146629] [ENSMUST00000227149] [ENSMUST00000228106]
Predicted Effect probably benign
Transcript: ENSMUST00000015903
SMART Domains Protein: ENSMUSP00000015903
Gene: ENSMUSG00000015759

DomainStartEndE-ValueType
Pfam:Cornichon 1 136 3e-50 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000067426
AA Change: V209A
SMART Domains Protein: ENSMUSP00000070575
Gene: ENSMUSG00000037628
AA Change: V209A

DomainStartEndE-ValueType
PTPc_DSPc 7 197 2.8e-3 SMART
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146629
SMART Domains Protein: ENSMUSP00000116885
Gene: ENSMUSG00000015759

DomainStartEndE-ValueType
Pfam:Cornichon 1 60 7.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226621
Predicted Effect probably benign
Transcript: ENSMUST00000227149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227583
Predicted Effect probably benign
Transcript: ENSMUST00000228106
Meta Mutation Damage Score 0.0700 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.7%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 C T 8: 86,506,866 R1269H probably damaging Het
Ace A G 11: 105,976,702 E164G probably null Het
Als2 A T 1: 59,170,008 V1464E possibly damaging Het
Atox1 A G 11: 55,450,553 L52P possibly damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Col16a1 A G 4: 130,057,999 K72E probably damaging Het
Col6a5 G A 9: 105,911,107 R1565* probably null Het
Col6a6 T C 9: 105,786,230 H36R probably benign Het
Cyp4b1 T C 4: 115,625,850 N415D possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dhcr24 T C 4: 106,561,239 F25L probably benign Het
Dhrs3 A G 4: 144,923,940 T219A probably benign Het
Dhx58 A G 11: 100,696,979 F584S probably damaging Het
Dmbt1 A G 7: 131,088,071 T715A probably benign Het
Eogt T A 6: 97,131,394 I229F probably benign Het
Ern2 T C 7: 122,180,964 T164A possibly damaging Het
Fam133b A T 5: 3,558,522 N84I probably damaging Het
Fbxl21 T A 13: 56,537,122 Y346* probably null Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Gm11492 T C 11: 87,567,244 V148A possibly damaging Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Golga3 T C 5: 110,201,998 probably benign Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kcnt2 A G 1: 140,609,639 N1119S probably benign Het
Klhl32 T C 4: 24,682,063 I207V probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lhfpl5 T C 17: 28,579,946 I143T possibly damaging Het
Lrrk1 T C 7: 66,305,521 K431E possibly damaging Het
Mag C T 7: 30,901,648 probably null Het
Maml3 A T 3: 51,856,930 N204K possibly damaging Het
Mrpl19 T C 6: 81,964,066 S115G probably damaging Het
Mthfd1l G C 10: 4,148,025 G954A probably damaging Het
Mut A G 17: 40,958,872 probably null Het
Myo19 A G 11: 84,892,175 I172V probably benign Het
Naca T C 10: 128,040,661 probably benign Het
Nfatc2 T C 2: 168,506,994 N638D possibly damaging Het
Nsun6 A G 2: 15,009,404 probably benign Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr584 C A 7: 103,085,750 D72E probably damaging Het
Olfr913 T A 9: 38,594,643 C141S probably damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Pafah1b1 G A 11: 74,690,232 S57F probably damaging Het
Prcd A G 11: 116,659,811 E103G possibly damaging Het
Prkx A T X: 77,771,275 F260I probably damaging Het
Rad54l2 A G 9: 106,753,943 probably null Het
Ranbp1 T C 16: 18,247,429 probably benign Het
Rb1cc1 T A 1: 6,249,366 M1003K probably benign Het
Scap A T 9: 110,374,025 M256L probably benign Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Tmem120b T A 5: 123,114,104 I146N probably damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Ube3a T A 7: 59,276,519 C348* probably null Het
Ubr4 T A 4: 139,421,855 D1777E probably benign Het
Unc79 C A 12: 103,113,217 D1880E probably damaging Het
Usp36 C T 11: 118,276,759 probably null Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Cdkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0374:Cdkn3 UTSW 14 46767173 splice site probably null
R0033:Cdkn3 UTSW 14 46768872 nonsense probably null
R0033:Cdkn3 UTSW 14 46768872 nonsense probably null
R0445:Cdkn3 UTSW 14 46767400 critical splice donor site probably null
R1912:Cdkn3 UTSW 14 46769834 critical splice acceptor site probably null
R3176:Cdkn3 UTSW 14 46771477 unclassified probably benign
R4941:Cdkn3 UTSW 14 46769863 missense possibly damaging 0.90
R5344:Cdkn3 UTSW 14 46767350 missense possibly damaging 0.94
R5964:Cdkn3 UTSW 14 46767217 missense probably null 1.00
R6039:Cdkn3 UTSW 14 46769916 missense probably damaging 1.00
R6039:Cdkn3 UTSW 14 46769916 missense probably damaging 1.00
R7073:Cdkn3 UTSW 14 46767190 missense possibly damaging 0.79
R7234:Cdkn3 UTSW 14 46771461 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCTACAGAATCTGCCCCTC -3'
(R):5'- CCTCTGCTGTGATACAACACCG -3'

Sequencing Primer
(F):5'- CTTCCCAAGTCCAATTAAAGGTTCAG -3'
(R):5'- CCGAATTCATGACTCAAGCATTAGG -3'
Posted On2015-01-23