Incidental Mutation 'R3277:Olfr1412'
ID258245
Institutional Source Beutler Lab
Gene Symbol Olfr1412
Ensembl Gene ENSMUSG00000046300
Gene Nameolfactory receptor 1412
SynonymsGA_x6K02T2R7CC-81165686-81164721, MOR208-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3277 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92585779-92591375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92588813 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 161 (N161S)
Ref Sequence ENSEMBL: ENSMUSP00000150943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062964] [ENSMUST00000190505]
Predicted Effect probably benign
Transcript: ENSMUST00000062964
AA Change: N161S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060291
Gene: ENSMUSG00000046300
AA Change: N161S

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
Pfam:7tm_4 38 314 7.8e-47 PFAM
Pfam:7tm_1 48 321 1.4e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190505
AA Change: N161S

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204141
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Cdx2 A T 5: 147,303,192 S225T probably benign Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Olfr1412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Olfr1412 APN 1 92588972 missense possibly damaging 0.52
IGL02177:Olfr1412 APN 1 92588757 missense possibly damaging 0.96
IGL02507:Olfr1412 APN 1 92588926 missense possibly damaging 0.68
IGL02888:Olfr1412 APN 1 92589203 missense probably damaging 1.00
IGL03001:Olfr1412 APN 1 92588551 missense probably damaging 1.00
R1771:Olfr1412 UTSW 1 92589115 missense probably benign 0.03
R1780:Olfr1412 UTSW 1 92588389 missense probably benign 0.01
R2215:Olfr1412 UTSW 1 92588986 missense probably benign 0.00
R2437:Olfr1412 UTSW 1 92588966 missense possibly damaging 0.46
R3176:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R3177:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R3276:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R4475:Olfr1412 UTSW 1 92588579 missense probably benign 0.00
R4892:Olfr1412 UTSW 1 92588921 missense probably benign 0.05
R5910:Olfr1412 UTSW 1 92588707 missense probably damaging 1.00
R6808:Olfr1412 UTSW 1 92589046 missense probably damaging 0.99
R7130:Olfr1412 UTSW 1 92588912 missense probably benign 0.10
R7476:Olfr1412 UTSW 1 92589264 missense probably benign
Z1088:Olfr1412 UTSW 1 92588551 missense probably damaging 1.00
Z1177:Olfr1412 UTSW 1 92588378 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAATGGCCAACTTCTATTCC -3'
(R):5'- CAGGATGACTAATGTTGCCCC -3'

Sequencing Primer
(F):5'- ATGGCCAACTTCTATTCCTCCAAAG -3'
(R):5'- TGTTGCCCCCATTAGAATGAAAC -3'
Posted On2015-01-23