Mutagenetix > Incidental Mutation

Incidental Mutation 'R3277:Lamc3'

258248

Institutional Source

Beutler Lab

Gene Symbol

Lamc3

Ensembl Gene

ENSMUSG00000026840

Gene Name

laminin gamma 3

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3277 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

31887291-31946539 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 31908625 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 448 (G448C)

Ref Sequence

ENSEMBL: ENSMUSP00000118745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]

AlphaFold

Q9R0B6

Predicted Effect

probably damaging
Transcript: ENSMUST00000028187
AA Change: G448C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: G448C

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1234	1247	N/A	INTRINSIC
low complexity region	1397	1407	N/A	INTRINSIC
coiled coil region	1444	1467	N/A	INTRINSIC
coiled coil region	1528	1575	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000138325
AA Change: G448C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: G448C

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1245	1258	N/A	INTRINSIC
low complexity region	1408	1418	N/A	INTRINSIC
coiled coil region	1455	1478	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Lamc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Lamc3	APN	2	31900581	missense	probably damaging	0.99
IGL00823:Lamc3	APN	2	31918521	missense	probably damaging	1.00
IGL01020:Lamc3	APN	2	31914656	missense	probably benign	0.07
IGL01086:Lamc3	APN	2	31898476	missense	probably damaging	1.00
IGL01618:Lamc3	APN	2	31912107	missense	probably damaging	0.99
IGL01655:Lamc3	APN	2	31898278	missense	probably damaging	1.00
IGL02093:Lamc3	APN	2	31887655	missense	probably damaging	1.00
IGL02309:Lamc3	APN	2	31914604	splice site	probably benign
IGL02340:Lamc3	APN	2	31918457	missense	probably damaging	1.00
IGL02410:Lamc3	APN	2	31905965	missense	probably damaging	0.99
IGL02548:Lamc3	APN	2	31920662	missense	probably benign	0.00
IGL02679:Lamc3	APN	2	31945398	missense	probably benign	0.01
IGL02751:Lamc3	APN	2	31920704	missense	probably benign	0.07
IGL02820:Lamc3	APN	2	31923022	missense	probably damaging	1.00
IGL02926:Lamc3	APN	2	31935725	splice site	probably benign
IGL02926:Lamc3	APN	2	31935726	splice site	probably benign
IGL03090:Lamc3	APN	2	31908698	splice site	probably benign
IGL03258:Lamc3	APN	2	31887683	missense	probably damaging	1.00
R0005:Lamc3	UTSW	2	31922428	missense	probably benign	0.07
R0137:Lamc3	UTSW	2	31908616	missense	probably damaging	1.00
R0179:Lamc3	UTSW	2	31915084	splice site	probably benign
R0244:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R0512:Lamc3	UTSW	2	31937968	missense	probably damaging	1.00
R1052:Lamc3	UTSW	2	31928802	missense	probably benign	0.03
R1142:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R1366:Lamc3	UTSW	2	31928847	missense	probably damaging	1.00
R1463:Lamc3	UTSW	2	31887411	missense	probably benign
R1515:Lamc3	UTSW	2	31940751	missense	probably damaging	1.00
R1642:Lamc3	UTSW	2	31915996	missense	probably damaging	1.00
R1692:Lamc3	UTSW	2	31921781	missense	probably null	0.01
R1707:Lamc3	UTSW	2	31912129	critical splice donor site	probably null
R1714:Lamc3	UTSW	2	31940757	missense	probably benign	0.02
R1838:Lamc3	UTSW	2	31925582	missense	possibly damaging	0.89
R2940:Lamc3	UTSW	2	31940702	missense	probably benign	0.02
R3177:Lamc3	UTSW	2	31908625	missense	probably damaging	1.00
R3846:Lamc3	UTSW	2	31924592	missense	probably benign	0.01
R4065:Lamc3	UTSW	2	31945258	missense	probably benign	0.00
R4089:Lamc3	UTSW	2	31920508	nonsense	probably null
R4373:Lamc3	UTSW	2	31898232	missense	probably damaging	1.00
R4394:Lamc3	UTSW	2	31931952	missense	probably benign
R4395:Lamc3	UTSW	2	31931952	missense	probably benign
R4397:Lamc3	UTSW	2	31931952	missense	probably benign
R4746:Lamc3	UTSW	2	31905614	missense	possibly damaging	0.77
R4948:Lamc3	UTSW	2	31940736	missense	probably benign	0.02
R4960:Lamc3	UTSW	2	31915954	missense	probably benign	0.00
R5025:Lamc3	UTSW	2	31908669	missense	probably benign	0.13
R5062:Lamc3	UTSW	2	31905667	missense	possibly damaging	0.60
R5170:Lamc3	UTSW	2	31887344	start codon destroyed	probably benign	0.03
R5286:Lamc3	UTSW	2	31918596	missense	probably damaging	1.00
R5457:Lamc3	UTSW	2	31931985	missense	probably benign
R5655:Lamc3	UTSW	2	31925717	missense	probably benign	0.01
R5928:Lamc3	UTSW	2	31921709	missense	probably benign	0.00
R6018:Lamc3	UTSW	2	31905712	missense	probably damaging	1.00
R6479:Lamc3	UTSW	2	31887401	missense	probably benign
R6601:Lamc3	UTSW	2	31920532	missense	possibly damaging	0.94
R6920:Lamc3	UTSW	2	31908689	missense	probably damaging	1.00
R6924:Lamc3	UTSW	2	31938069	missense	probably benign
R7114:Lamc3	UTSW	2	31930645	missense	probably damaging	0.99
R7305:Lamc3	UTSW	2	31930702	missense	probably benign	0.39
R7559:Lamc3	UTSW	2	31922368	missense	probably benign	0.00
R7714:Lamc3	UTSW	2	31922267	splice site	probably null
R7787:Lamc3	UTSW	2	31900539	missense	probably damaging	0.99
R7819:Lamc3	UTSW	2	31921763	missense	probably benign
R8171:Lamc3	UTSW	2	31914971	missense	probably benign	0.06
R8208:Lamc3	UTSW	2	31887414	missense	possibly damaging	0.47
R8412:Lamc3	UTSW	2	31912116	missense	probably damaging	0.98
R9058:Lamc3	UTSW	2	31908641	missense	probably benign	0.01
R9242:Lamc3	UTSW	2	31898311	missense	probably benign	0.14
R9269:Lamc3	UTSW	2	31923005	missense	probably benign	0.11
R9269:Lamc3	UTSW	2	31928896	nonsense	probably null
X0010:Lamc3	UTSW	2	31938012	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGTGGATGGATGCTAAGC -3'
(R):5'- AACGTGGGGTGACAGACTTG -3'

Sequencing Primer
(F):5'- TGCTAAGCAAGAGCATGGGTG -3'
(R):5'- TTGCCCAAGTCTCTGAGGAC -3'

Posted On

2015-01-23