Incidental Mutation 'R3277:Cdx2'
ID 258257
Institutional Source Beutler Lab
Gene Symbol Cdx2
Ensembl Gene ENSMUSG00000029646
Gene Name caudal type homeobox 2
Synonyms Cdx-2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3277 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 147300805-147307270 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 147303192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 225 (S225T)
Ref Sequence ENSEMBL: ENSMUSP00000031650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031650]
AlphaFold P43241
Predicted Effect probably benign
Transcript: ENSMUST00000031650
AA Change: S225T

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031650
Gene: ENSMUSG00000029646
AA Change: S225T

DomainStartEndE-ValueType
Pfam:Caudal_act 13 178 4.6e-38 PFAM
HOX 185 247 1.72e-25 SMART
low complexity region 285 305 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the caudal-related homeobox transcription factor gene family. The encoded protein is a major regulator of intestine-specific genes involved in cell growth an differentiation. This protein also plays a role in early embryonic development of the intestinal tract. Aberrant expression of this gene is associated with intestinal inflammation and tumorigenesis. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for targeted null mutations die prior to gastrulation. Heterozygotes exhibit tail abnormalities, stunted growth, defects of the vertebrae and ribs, and multiple intestinal adenomatous polyps. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,100 R553G possibly damaging Het
Adarb2 A G 13: 8,752,627 N646S probably damaging Het
Adcy8 C T 15: 64,699,159 G1242S probably benign Het
Ano9 T A 7: 141,104,124 T543S probably damaging Het
Btnl10 A G 11: 58,922,390 K282E probably benign Het
Btnl9 T C 11: 49,169,676 D330G probably damaging Het
Ccdc178 G T 18: 22,067,652 A416E possibly damaging Het
Clca4b T C 3: 144,911,359 I843M probably benign Het
Cntn4 G A 6: 106,437,964 probably null Het
Cyp4f18 T C 8: 71,993,200 D317G possibly damaging Het
Dennd4a G T 9: 64,888,993 R767L probably damaging Het
Dgkb G A 12: 38,084,217 V41M probably damaging Het
Duox1 T C 2: 122,340,116 Y1206H probably damaging Het
Dync1i1 T C 6: 5,972,211 probably null Het
Fbxw2 T C 2: 34,822,750 T100A probably benign Het
Fcgbp C A 7: 28,091,661 H782Q probably damaging Het
Flg2 A T 3: 93,214,888 Q1455L unknown Het
Frrs1 T C 3: 116,899,224 F49S probably damaging Het
Gli3 A T 13: 15,725,982 Q1318L probably benign Het
Gm5592 A G 7: 41,288,380 E362G probably benign Het
Gm7104 A T 12: 88,285,728 noncoding transcript Het
Gpatch2l A G 12: 86,244,315 T91A possibly damaging Het
Hacd4 T C 4: 88,437,510 H46R probably damaging Het
Herc2 T C 7: 56,153,428 V2175A probably benign Het
Hey1 T C 3: 8,664,891 S169G probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hlf T C 11: 90,345,835 K199E probably damaging Het
Hpgd C A 8: 56,298,413 A92E probably damaging Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Itgad C A 7: 128,190,981 H651N possibly damaging Het
Itgav A G 2: 83,776,542 D409G probably damaging Het
Kif2a A G 13: 106,976,756 I455T probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc3 G T 2: 31,908,625 G448C probably damaging Het
Ltbp1 G A 17: 75,276,480 G425D possibly damaging Het
Ltbp1 T A 17: 75,359,278 probably null Het
Mag C T 7: 30,901,648 probably null Het
Mdh1b G A 1: 63,711,531 T426M possibly damaging Het
Nr1h4 G A 10: 89,478,788 T282I possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1231 C T 2: 89,303,218 V125M possibly damaging Het
Olfr1412 A G 1: 92,588,813 N161S probably benign Het
Olfr552 T C 7: 102,604,576 V74A possibly damaging Het
Padi6 A G 4: 140,735,389 L307P probably damaging Het
Parp9 T C 16: 35,948,208 S20P probably damaging Het
Pdcd11 T C 19: 47,113,264 F963L probably damaging Het
Pwp1 C T 10: 85,882,079 L294F probably benign Het
Radil A G 5: 142,506,856 L339P probably damaging Het
Raver1 G A 9: 21,079,277 P316S possibly damaging Het
Rell1 A G 5: 63,926,987 probably null Het
Rxrg A G 1: 167,635,700 D257G possibly damaging Het
Sema4c C T 1: 36,549,879 R722H possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Spata7 A G 12: 98,637,598 N75D possibly damaging Het
Ttc23l A G 15: 10,547,232 F99L possibly damaging Het
Unc13a A C 8: 71,629,695 C1642G probably benign Het
Usp36 C T 11: 118,276,759 probably null Het
Wrn A G 8: 33,317,554 M292T probably damaging Het
Zfp423 A G 8: 87,782,331 Y462H probably damaging Het
Zscan5b T A 7: 6,231,346 Y124N possibly damaging Het
Zswim9 T C 7: 13,277,270 T51A possibly damaging Het
Other mutations in Cdx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Cdx2 APN 5 147306982 start codon destroyed possibly damaging 0.93
IGL01471:Cdx2 APN 5 147303249 missense probably benign 0.00
IGL02578:Cdx2 APN 5 147303284 missense probably damaging 1.00
Brubeck UTSW 5 147303287 missense probably damaging 1.00
R0238:Cdx2 UTSW 5 147303287 missense probably damaging 1.00
R0238:Cdx2 UTSW 5 147303287 missense probably damaging 1.00
R0239:Cdx2 UTSW 5 147303287 missense probably damaging 1.00
R0239:Cdx2 UTSW 5 147303287 missense probably damaging 1.00
R0245:Cdx2 UTSW 5 147306473 missense possibly damaging 0.79
R0464:Cdx2 UTSW 5 147306473 missense possibly damaging 0.79
R0465:Cdx2 UTSW 5 147306473 missense possibly damaging 0.79
R1463:Cdx2 UTSW 5 147306660 missense probably benign 0.10
R3177:Cdx2 UTSW 5 147303192 missense probably benign 0.25
R4166:Cdx2 UTSW 5 147306729 missense possibly damaging 0.48
R5732:Cdx2 UTSW 5 147302023 missense possibly damaging 0.88
R6002:Cdx2 UTSW 5 147303234 missense probably damaging 0.98
R7381:Cdx2 UTSW 5 147306630 missense possibly damaging 0.92
R7489:Cdx2 UTSW 5 147306672 missense probably benign 0.16
R8307:Cdx2 UTSW 5 147306667 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGTGCAGTTCCACCCTGTAG -3'
(R):5'- TAGGGAGGTTTGTCATTACCAATG -3'

Sequencing Primer
(F):5'- ACCCTGTAGCCTCGACTTGG -3'
(R):5'- CCAATGACTGATGGATTGTAGTTC -3'
Posted On 2015-01-23