Mutagenetix > Incidental Mutation

Incidental Mutation 'R3277:Cntn4'

258259

Institutional Source

Beutler Lab

Gene Symbol

Cntn4

Ensembl Gene

ENSMUSG00000064293

Gene Name

contactin 4

Synonyms

BIG-2A, Axcam

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.343) question?

Stock #

R3277 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105677660-106699310 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 106437964 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079416] [ENSMUST00000079416] [ENSMUST00000089208] [ENSMUST00000089208] [ENSMUST00000113258] [ENSMUST00000113260] [ENSMUST00000113261] [ENSMUST00000113264] [ENSMUST00000113264]

AlphaFold

Q69Z26

Predicted Effect

probably null
Transcript: ENSMUST00000079416

SMART Domains

Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	2.32e-8	SMART
IG	129	215	3.4e-6	SMART
IGc2	238	302	8.76e-18	SMART
IGc2	328	391	2.91e-14	SMART
IGc2	420	484	1.58e-10	SMART
IG	504	594	9.55e-10	SMART
FN3	597	683	1.54e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000079416

SMART Domains

Protein: ENSMUSP00000078385
Gene: ENSMUSG00000064293

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	2.32e-8	SMART
IG	129	215	3.4e-6	SMART
IGc2	238	302	8.76e-18	SMART
IGc2	328	391	2.91e-14	SMART
IGc2	420	484	1.58e-10	SMART
IG	504	594	9.55e-10	SMART
FN3	597	683	1.54e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000089208

SMART Domains

Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	2.32e-8	SMART
IG	129	215	3.4e-6	SMART
IGc2	238	302	8.76e-18	SMART
IGc2	328	391	2.91e-14	SMART
IGc2	420	484	1.58e-10	SMART
IG	504	594	9.55e-10	SMART
FN3	597	683	1.54e-11	SMART
FN3	700	786	8.39e0	SMART
FN3	801	886	1.33e-6	SMART
FN3	901	981	9.85e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000089208

SMART Domains

Protein: ENSMUSP00000086616
Gene: ENSMUSG00000064293

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	2.32e-8	SMART
IG	129	215	3.4e-6	SMART
IGc2	238	302	8.76e-18	SMART
IGc2	328	391	2.91e-14	SMART
IGc2	420	484	1.58e-10	SMART
IG	504	594	9.55e-10	SMART
FN3	597	683	1.54e-11	SMART
FN3	700	786	8.39e0	SMART
FN3	801	886	1.33e-6	SMART
FN3	901	981	9.85e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113258

SMART Domains

Protein: ENSMUSP00000108883
Gene: ENSMUSG00000064293

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	2.32e-8	SMART
IG	129	215	3.4e-6	SMART
IGc2	238	302	8.76e-18	SMART
IGc2	328	391	2.91e-14	SMART
IGc2	420	484	1.58e-10	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113260

SMART Domains

Protein: ENSMUSP00000108885
Gene: ENSMUSG00000064293

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	2.32e-8	SMART
IG	129	215	3.4e-6	SMART
IGc2	238	302	8.76e-18	SMART
IGc2	328	391	2.91e-14	SMART
IGc2	420	484	1.58e-10	SMART
IG	504	594	9.55e-10	SMART
FN3	597	683	1.54e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113261

SMART Domains

Protein: ENSMUSP00000108886
Gene: ENSMUSG00000064293

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	2.32e-8	SMART
IG	129	215	3.4e-6	SMART
IGc2	238	302	8.76e-18	SMART
IGc2	328	391	2.91e-14	SMART
IGc2	420	484	1.58e-10	SMART
IG	504	594	9.55e-10	SMART
FN3	597	683	1.54e-11	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113264

SMART Domains

Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	2.32e-8	SMART
IG	129	215	3.4e-6	SMART
IGc2	238	302	8.76e-18	SMART
IGc2	328	391	2.91e-14	SMART
IGc2	420	484	1.58e-10	SMART
IG	504	594	9.55e-10	SMART
FN3	597	683	1.54e-11	SMART
FN3	700	786	8.39e0	SMART
FN3	801	886	1.33e-6	SMART
FN3	901	981	9.85e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113264

SMART Domains

Protein: ENSMUSP00000108889
Gene: ENSMUSG00000064293

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	2.32e-8	SMART
IG	129	215	3.4e-6	SMART
IGc2	238	302	8.76e-18	SMART
IGc2	328	391	2.91e-14	SMART
IGc2	420	484	1.58e-10	SMART
IG	504	594	9.55e-10	SMART
FN3	597	683	1.54e-11	SMART
FN3	700	786	8.39e0	SMART
FN3	801	886	1.33e-6	SMART
FN3	901	981	9.85e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125904

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the contactin family of immunoglobulins. Contactins are axon-associated cell adhesion molecules that function in neuronal network formation and plasticity. The encoded protein is a glycosylphosphatidylinositol-anchored neuronal membrane protein that may play a role in the formation of axon connections in the developing nervous system. Deletion or mutation of this gene may play a role in 3p deletion syndrome and autism spectrum disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aberrant projection of olfactory axons to multiple glomeruli in the olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Cntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cntn4	APN	6	106506225	missense	probably damaging	1.00
IGL00725:Cntn4	APN	6	106662655	missense	probably damaging	1.00
IGL01062:Cntn4	APN	6	106618278	splice site	probably benign
IGL01432:Cntn4	APN	6	106678334	splice site	probably benign
IGL01585:Cntn4	APN	6	106618328	nonsense	probably null
IGL01710:Cntn4	APN	6	106550431	missense	possibly damaging	0.87
IGL01870:Cntn4	APN	6	106489715	missense	possibly damaging	0.95
IGL01933:Cntn4	APN	6	106694384	missense	probably damaging	0.99
IGL01937:Cntn4	APN	6	106437904	missense	probably damaging	1.00
IGL01945:Cntn4	APN	6	106437904	missense	probably damaging	1.00
IGL02007:Cntn4	APN	6	106655529	missense	probably benign	0.03
IGL02506:Cntn4	APN	6	106618388	missense	probably benign	0.24
IGL02561:Cntn4	APN	6	106523509	missense	probably damaging	1.00
IGL03080:Cntn4	APN	6	106655539	missense	probably damaging	1.00
IGL03338:Cntn4	APN	6	106655589	missense	probably damaging	0.98
IGL03097:Cntn4	UTSW	6	106353712	missense	probably benign	0.10
LCD18:Cntn4	UTSW	6	106553940	intron	probably benign
R0083:Cntn4	UTSW	6	106525369	missense	possibly damaging	0.79
R0098:Cntn4	UTSW	6	106618424	splice site	probably benign
R0501:Cntn4	UTSW	6	106618335	missense	probably damaging	1.00
R0626:Cntn4	UTSW	6	106662578	missense	probably benign	0.07
R0633:Cntn4	UTSW	6	106679248	splice site	probably null
R0730:Cntn4	UTSW	6	106550486	missense	probably damaging	1.00
R0849:Cntn4	UTSW	6	106667457	missense	probably damaging	1.00
R0883:Cntn4	UTSW	6	106667540	splice site	probably benign
R0926:Cntn4	UTSW	6	106655581	missense	probably benign	0.21
R1199:Cntn4	UTSW	6	106353597	splice site	probably benign
R1293:Cntn4	UTSW	6	106353724	missense	probably benign	0.00
R1296:Cntn4	UTSW	6	106509402	missense	probably damaging	1.00
R1344:Cntn4	UTSW	6	106344870	splice site	probably null
R1418:Cntn4	UTSW	6	106344870	splice site	probably null
R1660:Cntn4	UTSW	6	106679297	missense	probably benign	0.35
R1751:Cntn4	UTSW	6	106618410	critical splice donor site	probably null
R1883:Cntn4	UTSW	6	106679392	missense	probably benign	0.01
R1884:Cntn4	UTSW	6	106679392	missense	probably benign	0.01
R1899:Cntn4	UTSW	6	106675813	missense	probably benign	0.21
R1906:Cntn4	UTSW	6	106353646	missense	probably benign	0.00
R2048:Cntn4	UTSW	6	106437864	splice site	probably benign
R2113:Cntn4	UTSW	6	106489697	missense	probably damaging	1.00
R3177:Cntn4	UTSW	6	106437964	critical splice donor site	probably null
R3944:Cntn4	UTSW	6	106618414	missense	probably benign	0.10
R4401:Cntn4	UTSW	6	106489664	missense	possibly damaging	0.94
R4540:Cntn4	UTSW	6	106675748	missense	probably damaging	1.00
R4688:Cntn4	UTSW	6	106437949	missense	probably damaging	1.00
R4697:Cntn4	UTSW	6	106525485	missense	probably damaging	1.00
R4810:Cntn4	UTSW	6	106655611	missense	probably benign	0.04
R4816:Cntn4	UTSW	6	106550497	missense	probably benign
R4873:Cntn4	UTSW	6	106437913	missense	possibly damaging	0.61
R4875:Cntn4	UTSW	6	106437913	missense	possibly damaging	0.61
R4953:Cntn4	UTSW	6	106525418	missense	probably benign	0.01
R5288:Cntn4	UTSW	6	106181804	missense	possibly damaging	0.60
R5336:Cntn4	UTSW	6	106662634	missense	possibly damaging	0.72
R5386:Cntn4	UTSW	6	106181804	missense	possibly damaging	0.60
R5477:Cntn4	UTSW	6	106673950	missense	possibly damaging	0.88
R5514:Cntn4	UTSW	6	106672883	missense	probably damaging	1.00
R5668:Cntn4	UTSW	6	106679436	splice site	silent
R6334:Cntn4	UTSW	6	106344786	missense	probably benign
R6334:Cntn4	UTSW	6	106506192	missense	probably benign	0.29
R6904:Cntn4	UTSW	6	106697583	missense	probably benign	0.03
R6985:Cntn4	UTSW	6	106679417	missense	probably benign	0.03
R7246:Cntn4	UTSW	6	106506219	missense	probably damaging	1.00
R7282:Cntn4	UTSW	6	106525460	missense	probably damaging	0.99
R7585:Cntn4	UTSW	6	106489611	missense	probably damaging	1.00
R7667:Cntn4	UTSW	6	106679895	missense	possibly damaging	0.83
R7781:Cntn4	UTSW	6	106523614	missense	probably damaging	1.00
R7882:Cntn4	UTSW	6	106353723	missense	probably benign
R8081:Cntn4	UTSW	6	106674607	missense	possibly damaging	0.95
R8105:Cntn4	UTSW	6	106353606	missense	probably damaging	1.00
R8221:Cntn4	UTSW	6	106509510	missense	probably benign	0.17
R8910:Cntn4	UTSW	6	106655536	missense	probably benign	0.10
R8911:Cntn4	UTSW	6	106353782	critical splice donor site	probably null
R8916:Cntn4	UTSW	6	106675954	missense	probably damaging	0.99
R9249:Cntn4	UTSW	6	106489761	missense	possibly damaging	0.95
R9376:Cntn4	UTSW	6	106662630	missense	probably damaging	1.00
R9616:Cntn4	UTSW	6	106697564	nonsense	probably null
R9767:Cntn4	UTSW	6	106678434	missense	probably benign	0.40
Z1176:Cntn4	UTSW	6	106509464	missense	probably benign	0.28
Z1176:Cntn4	UTSW	6	106523563	missense	probably benign	0.00
Z1177:Cntn4	UTSW	6	106550425	missense	probably damaging	1.00
Z1177:Cntn4	UTSW	6	106662618	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACAGCTACCTTCTGGGAAATTG -3'
(R):5'- TTGTGCCAGGCATATGGTGAC -3'

Sequencing Primer
(F):5'- GAAATTGTCATAGTGCCCCATGG -3'
(R):5'- GGTGACATGGGACATTTGT -3'

Posted On

2015-01-23