Mutagenetix > Incidental Mutation

Incidental Mutation 'R3277:Klk14'

258263

Institutional Source

Beutler Lab

Gene Symbol

Klk14

Ensembl Gene

ENSMUSG00000044737

Gene Name

kallikrein related-peptidase 14

Synonyms

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3277 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43690418-43695536 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 43692077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 51 (C51Y)

Ref Sequence

ENSEMBL: ENSMUSP00000056935 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056329]

AlphaFold

Q8CGR5

Predicted Effect

probably damaging
Transcript: ENSMUST00000056329
AA Change: C51Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056935
Gene: ENSMUSG00000044737
AA Change: C51Y

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
Tryp_SPc	23	243	2.02e-93	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205416

Meta Mutation Damage Score

0.7935

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that have diverse physiological functions such as regulation of blood pressure and desquamation. The encoded protein is a precursor that undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. The encoded enzyme was found to activate the complement pathway by cleavage of C3 to release C3a anaphylotoxin. This gene is one of the several glandular kallikrein genes located in a cluster on chromosome 7. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Klk14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0309:Klk14	UTSW	7	43694345	missense	probably benign	0.01
R0467:Klk14	UTSW	7	43694110	missense	probably benign	0.33
R1432:Klk14	UTSW	7	43694918	missense	probably damaging	1.00
R1575:Klk14	UTSW	7	43693953	critical splice acceptor site	probably null
R2160:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R2185:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R2188:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R2189:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R2472:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R2474:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R2961:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R2962:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R2968:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R3147:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R3148:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R3176:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R3177:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R3276:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R3418:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R3419:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R3430:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R3956:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4080:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4081:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4152:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4153:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4169:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4205:Klk14	UTSW	7	43694934	missense	probably benign	0.00
R4284:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4285:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4287:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4356:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4359:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4379:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4380:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4381:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4611:Klk14	UTSW	7	43694357	missense	probably damaging	1.00
R4684:Klk14	UTSW	7	43691968	missense	probably benign
R4784:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4792:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4793:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4825:Klk14	UTSW	7	43692076	missense	probably damaging	1.00
R4844:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4847:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4884:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4898:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4941:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4942:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4943:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4972:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R4997:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5021:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5022:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5024:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5053:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5054:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5056:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5057:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5097:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5253:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5257:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5459:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5489:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5490:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5493:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R5543:Klk14	UTSW	7	43692077	missense	probably damaging	1.00
R6823:Klk14	UTSW	7	43694456	nonsense	probably null
R7960:Klk14	UTSW	7	43692043	missense	probably damaging	1.00
R7993:Klk14	UTSW	7	43694943	missense	probably benign	0.01
R8220:Klk14	UTSW	7	43694074	missense	probably damaging	1.00
R8701:Klk14	UTSW	7	43694142	missense	possibly damaging	0.49
R8880:Klk14	UTSW	7	43694035	missense	probably damaging	0.99
X0064:Klk14	UTSW	7	43694110	missense	probably benign	0.33

Predicted Primers

PCR Primer
(F):5'- AAAGATCTCTGTCTGCTGGGC -3'
(R):5'- GGCAAGGGTTCTACATACACTCTG -3'

Sequencing Primer
(F):5'- ATCTCTGTCTGCTGGGCATTGG -3'
(R):5'- TGAATTATGCCTCTCAGCCTAG -3'

Posted On

2015-01-23