Mutagenetix > Incidental Mutation

Incidental Mutation 'R3277:Wrn'

258268

Institutional Source

Beutler Lab

Gene Symbol

Wrn

Ensembl Gene

ENSMUSG00000031583

Gene Name

Werner syndrome RecQ like helicase

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.331) question?

Stock #

R3277 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33234384-33385527 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 33317554 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 292 (M292T)

Ref Sequence

ENSEMBL: ENSMUSP00000147379 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]

AlphaFold

O09053

Predicted Effect

probably damaging
Transcript: ENSMUST00000033990
AA Change: M535T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: M535T

Domain	Start	End	E-Value	Type
35EXOc	47	226	1e-47	SMART
low complexity region	484	489	N/A	INTRINSIC
DEXDc	509	704	2.3e-28	SMART
HELICc	743	824	3.7e-27	SMART
RQC	923	1028	3.1e-28	SMART
HRDC	1115	1194	1.5e-26	SMART
low complexity region	1205	1216	N/A	INTRINSIC
Pfam:HTH_40	1222	1318	2.7e-9	PFAM
low complexity region	1342	1356	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000033991
AA Change: M535T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: M535T

Domain	Start	End	E-Value	Type
35EXOc	47	226	1.1e-47	SMART
low complexity region	484	489	N/A	INTRINSIC
DEXDc	509	704	2.4e-28	SMART
HELICc	743	824	3.7e-27	SMART
Pfam:RecQ_Zn_bind	835	905	2.2e-8	PFAM
RQC	923	1028	3.2e-28	SMART
HRDC	1115	1194	1.5e-26	SMART
low complexity region	1205	1216	N/A	INTRINSIC
Pfam:HTH_40	1223	1317	4.3e-10	PFAM
low complexity region	1342	1356	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211498
AA Change: M292T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Wrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00659:Wrn	APN	8	33322377	splice site	probably benign
IGL00661:Wrn	APN	8	33319145	splice site	probably benign
IGL01472:Wrn	APN	8	33329172	missense	possibly damaging	0.93
IGL01544:Wrn	APN	8	33324526	missense	probably benign	0.00
IGL01599:Wrn	APN	8	33241011	missense	possibly damaging	0.69
IGL01688:Wrn	APN	8	33310702	splice site	probably benign
IGL01916:Wrn	APN	8	33257224	missense	possibly damaging	0.78
IGL01925:Wrn	APN	8	33319180	missense	probably benign	0.42
IGL02068:Wrn	APN	8	33310749	missense	probably benign	0.38
IGL02084:Wrn	APN	8	33285179	missense	probably benign
IGL02167:Wrn	APN	8	33317555	missense	probably damaging	1.00
IGL02230:Wrn	APN	8	33317563	missense	probably damaging	1.00
IGL02717:Wrn	APN	8	33343573	missense	probably damaging	1.00
IGL02982:Wrn	APN	8	33343066	missense	probably damaging	1.00
IGL03030:Wrn	APN	8	33248961	missense	possibly damaging	0.94
IGL03088:Wrn	APN	8	33268823	splice site	probably benign
IGL03179:Wrn	APN	8	33310706	splice site	probably null
IGL03306:Wrn	APN	8	33336121	missense	probably damaging	1.00
R0004:Wrn	UTSW	8	33317560	missense	probably damaging	1.00
R0190:Wrn	UTSW	8	33240983	missense	probably benign	0.02
R0441:Wrn	UTSW	8	33268750	missense	probably benign	0.24
R0463:Wrn	UTSW	8	33280815	missense	possibly damaging	0.84
R0538:Wrn	UTSW	8	33336091	missense	probably damaging	0.99
R0682:Wrn	UTSW	8	33267820	missense	probably benign	0.00
R0729:Wrn	UTSW	8	33248918	splice site	probably null
R0744:Wrn	UTSW	8	33295006	missense	possibly damaging	0.91
R0836:Wrn	UTSW	8	33295006	missense	possibly damaging	0.91
R1168:Wrn	UTSW	8	33316408	missense	probably damaging	1.00
R1301:Wrn	UTSW	8	33292686	missense	probably damaging	1.00
R1352:Wrn	UTSW	8	33294916	missense	probably benign	0.25
R1396:Wrn	UTSW	8	33268819	missense	probably damaging	1.00
R1432:Wrn	UTSW	8	33319141	splice site	probably benign
R1523:Wrn	UTSW	8	33292716	missense	probably benign	0.23
R1625:Wrn	UTSW	8	33329130	missense	probably benign	0.01
R1664:Wrn	UTSW	8	33280766	splice site	probably null
R1773:Wrn	UTSW	8	33343561	missense	probably damaging	1.00
R1864:Wrn	UTSW	8	33288864	missense	probably damaging	0.99
R1868:Wrn	UTSW	8	33257221	missense	probably benign	0.03
R2011:Wrn	UTSW	8	33236404	missense	probably benign	0.02
R2075:Wrn	UTSW	8	33322329	missense	probably benign	0.00
R2091:Wrn	UTSW	8	33267825	missense	probably benign
R2213:Wrn	UTSW	8	33257015	missense	probably benign	0.05
R2255:Wrn	UTSW	8	33329202	missense	probably benign	0.13
R2276:Wrn	UTSW	8	33324556	missense	probably benign	0.02
R3177:Wrn	UTSW	8	33317554	missense	probably damaging	1.00
R3779:Wrn	UTSW	8	33241020	missense	probably damaging	1.00
R3827:Wrn	UTSW	8	33324520	missense	probably benign	0.00
R4111:Wrn	UTSW	8	33352155	missense	probably benign	0.02
R4392:Wrn	UTSW	8	33251832	missense	probably damaging	0.99
R4458:Wrn	UTSW	8	33294998	missense	probably damaging	0.99
R4650:Wrn	UTSW	8	33255509	missense	probably benign	0.05
R4656:Wrn	UTSW	8	33335991	splice site	probably null
R4657:Wrn	UTSW	8	33335991	splice site	probably null
R4667:Wrn	UTSW	8	33324338	missense	probably benign	0.00
R4735:Wrn	UTSW	8	33285222	missense	probably damaging	1.00
R4933:Wrn	UTSW	8	33322343	missense	probably benign	0.01
R5104:Wrn	UTSW	8	33267867	splice site	probably null
R5166:Wrn	UTSW	8	33352072	critical splice donor site	probably null
R5279:Wrn	UTSW	8	33241101	missense	probably damaging	1.00
R5400:Wrn	UTSW	8	33294917	missense	probably benign	0.02
R5575:Wrn	UTSW	8	33336130	missense	probably benign	0.02
R5695:Wrn	UTSW	8	33324318	missense	probably benign	0.26
R5729:Wrn	UTSW	8	33268778	missense	probably benign	0.02
R6044:Wrn	UTSW	8	33236429	missense	probably damaging	1.00
R6139:Wrn	UTSW	8	33353332	missense	probably damaging	1.00
R6158:Wrn	UTSW	8	33319172	missense	probably damaging	1.00
R6192:Wrn	UTSW	8	33284654	missense	probably benign	0.12
R6243:Wrn	UTSW	8	33284654	missense	possibly damaging	0.94
R6354:Wrn	UTSW	8	33343638	missense	possibly damaging	0.93
R6429:Wrn	UTSW	8	33342996	missense	probably damaging	1.00
R6490:Wrn	UTSW	8	33319220	missense	probably benign	0.01
R6529:Wrn	UTSW	8	33335976	splice site	probably null
R6535:Wrn	UTSW	8	33336103	missense	probably damaging	0.99
R7001:Wrn	UTSW	8	33352129	missense	probably benign	0.04
R7114:Wrn	UTSW	8	33285121	frame shift	probably null
R7198:Wrn	UTSW	8	33324318	missense	probably benign	0.00
R7200:Wrn	UTSW	8	33322348	missense	probably benign	0.00
R7227:Wrn	UTSW	8	33248946	missense	probably damaging	1.00
R7299:Wrn	UTSW	8	33292718	missense	probably damaging	1.00
R7374:Wrn	UTSW	8	33268911	missense	probably damaging	1.00
R7402:Wrn	UTSW	8	33248966	missense	probably benign	0.00
R7404:Wrn	UTSW	8	33248966	missense	probably benign	0.00
R7405:Wrn	UTSW	8	33248966	missense	probably benign	0.00
R7464:Wrn	UTSW	8	33335996	critical splice donor site	probably null
R7474:Wrn	UTSW	8	33329181	missense	probably damaging	0.96
R7609:Wrn	UTSW	8	33310713	missense	possibly damaging	0.50
R7729:Wrn	UTSW	8	33324426	missense	probably benign	0.21
R7830:Wrn	UTSW	8	33269054	missense	probably damaging	0.97
R7998:Wrn	UTSW	8	33292643	missense	probably benign	0.10
R8239:Wrn	UTSW	8	33329185	missense	probably damaging	1.00
R8262:Wrn	UTSW	8	33324246	missense	probably benign	0.07
R8410:Wrn	UTSW	8	33269020	missense	probably damaging	1.00
R8480:Wrn	UTSW	8	33288768	missense	probably benign	0.10
R8530:Wrn	UTSW	8	33280824	missense	possibly damaging	0.83
R8540:Wrn	UTSW	8	33352126	missense	probably damaging	0.96
R8708:Wrn	UTSW	8	33292643	missense	probably damaging	0.96
R8783:Wrn	UTSW	8	33336013	missense	probably null	1.00
R8870:Wrn	UTSW	8	33329192	missense	probably benign	0.01
R8876:Wrn	UTSW	8	33324394	missense	probably benign	0.00
R9050:Wrn	UTSW	8	33342993	missense	probably damaging	1.00
R9329:Wrn	UTSW	8	33240978	missense	probably benign
R9595:Wrn	UTSW	8	33268933	missense	probably benign
R9621:Wrn	UTSW	8	33324273	missense	probably benign	0.01
R9623:Wrn	UTSW	8	33284616	critical splice donor site	probably null
R9797:Wrn	UTSW	8	33268922	missense	probably benign	0.02
RF010:Wrn	UTSW	8	33288765	missense	probably benign	0.13
X0017:Wrn	UTSW	8	33280782	missense	probably damaging	1.00
Z1176:Wrn	UTSW	8	33334209	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGAAGCACAGACTCTTCCC -3'
(R):5'- CAACTCATGGTTATTCAGTCAGTCTG -3'

Sequencing Primer
(F):5'- TGGAAGCACAGACTCTTCCCATATC -3'
(R):5'- AACTTGTGCTTTGGATGCT -3'

Posted On

2015-01-23