Mutagenetix > Incidental Mutation

Incidental Mutation 'R3277:Unc13a'

258269

Institutional Source

Beutler Lab

Gene Symbol

Unc13a

Ensembl Gene

ENSMUSG00000034799

Gene Name

unc-13 homolog A (C. elegans)

Synonyms

2410078G03Rik, Munc13-1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3277 (G1)

Quality Score

143

Status

Not validated

Chromosome

Chromosomal Location

71624417-71671757 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 71629695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 1642 (C1642G)

Ref Sequence

ENSEMBL: ENSMUSP00000135189 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000047903] [ENSMUST00000177517]

AlphaFold

Q4KUS2

Predicted Effect

probably benign
Transcript: ENSMUST00000030170
AA Change: C1623G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: C1623G

Domain	Start	End	E-Value	Type
C2	3	94	5.23e-10	SMART
low complexity region	187	202	N/A	INTRINSIC
low complexity region	264	277	N/A	INTRINSIC
low complexity region	299	310	N/A	INTRINSIC
coiled coil region	321	359	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	435	450	N/A	INTRINSIC
PDB:2KDU\|B	454	488	3e-16	PDB
C1	563	612	3.93e-18	SMART
C2	686	793	5.86e-22	SMART
DUF1041	1002	1111	1.6e-56	SMART
Pfam:Membr_traf_MHD	1355	1520	6.3e-53	PFAM
C2	1555	1661	5.03e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000047903

SMART Domains

Protein: ENSMUSP00000047923
Gene: ENSMUSG00000034807

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
Pfam:Glyco_tranf_2_4	56	176	4.6e-22	PFAM
Pfam:Glyco_transf_25	335	520	8.8e-37	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175909

Predicted Effect

probably benign
Transcript: ENSMUST00000177517
AA Change: C1642G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: C1642G

Domain	Start	End	E-Value	Type
C2	3	94	5.23e-10	SMART
low complexity region	187	202	N/A	INTRINSIC
low complexity region	264	277	N/A	INTRINSIC
low complexity region	299	310	N/A	INTRINSIC
coiled coil region	321	359	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	435	450	N/A	INTRINSIC
PDB:2KDU\|B	454	488	3e-16	PDB
C1	563	612	3.93e-18	SMART
C2	686	793	5.86e-22	SMART
DUF1041	1002	1111	1.6e-56	SMART
Pfam:Membr_traf_MHD	1355	1520	6.7e-53	PFAM
C2	1574	1680	5.03e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184793

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212706

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Unc13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Unc13a	APN	8	71643147	missense	probably null	0.70
IGL01023:Unc13a	APN	8	71661825	missense	probably benign	0.02
IGL01456:Unc13a	APN	8	71644567	missense	probably damaging	1.00
IGL01820:Unc13a	APN	8	71654947	missense	probably damaging	0.99
IGL01909:Unc13a	APN	8	71639210	splice site	probably benign
IGL01925:Unc13a	APN	8	71634543	missense	possibly damaging	0.95
IGL02407:Unc13a	APN	8	71648942	missense	probably damaging	0.99
IGL02622:Unc13a	APN	8	71652514	splice site	probably null
IGL02634:Unc13a	APN	8	71655701	missense	probably benign	0.03
IGL02724:Unc13a	APN	8	71656305	splice site	probably benign
IGL02892:Unc13a	APN	8	71649910	missense	probably damaging	1.00
IGL02948:Unc13a	APN	8	71650549	missense	possibly damaging	0.63
IGL03081:Unc13a	APN	8	71649549	missense	probably damaging	0.98
IGL03372:Unc13a	APN	8	71655709	missense	probably damaging	1.00
curvy	UTSW	8	71630504	splice site	probably null
Greed	UTSW	8	71654845	missense	probably damaging	1.00
largesse	UTSW	8	71634658	missense	probably damaging	1.00
serpiginous	UTSW	8	71664245	missense	probably damaging	1.00
PIT4469001:Unc13a	UTSW	8	71658314	nonsense	probably null
R0067:Unc13a	UTSW	8	71634658	missense	probably damaging	1.00
R0067:Unc13a	UTSW	8	71634658	missense	probably damaging	1.00
R0389:Unc13a	UTSW	8	71658032	missense	probably benign	0.01
R0457:Unc13a	UTSW	8	71658001	critical splice donor site	probably null
R0478:Unc13a	UTSW	8	71651148	missense	possibly damaging	0.92
R0483:Unc13a	UTSW	8	71644913	missense	probably damaging	0.96
R0609:Unc13a	UTSW	8	71658467	missense	probably damaging	0.96
R0611:Unc13a	UTSW	8	71649865	missense	probably damaging	1.00
R0730:Unc13a	UTSW	8	71656285	missense	possibly damaging	0.68
R0883:Unc13a	UTSW	8	71642173	nonsense	probably null
R1162:Unc13a	UTSW	8	71647917	missense	probably benign	0.31
R1185:Unc13a	UTSW	8	71661833	missense	probably benign	0.13
R1185:Unc13a	UTSW	8	71661833	missense	probably benign	0.13
R1185:Unc13a	UTSW	8	71661833	missense	probably benign	0.13
R1196:Unc13a	UTSW	8	71654986	missense	probably damaging	1.00
R1400:Unc13a	UTSW	8	71651221	missense	probably damaging	1.00
R1446:Unc13a	UTSW	8	71648981	missense	possibly damaging	0.91
R1507:Unc13a	UTSW	8	71658266	missense	probably benign
R1636:Unc13a	UTSW	8	71653390	missense	probably damaging	1.00
R1858:Unc13a	UTSW	8	71652399	missense	probably damaging	1.00
R2025:Unc13a	UTSW	8	71639768	missense	possibly damaging	0.92
R2107:Unc13a	UTSW	8	71656251	splice site	probably null
R2286:Unc13a	UTSW	8	71630559	missense	probably damaging	1.00
R2334:Unc13a	UTSW	8	71634558	missense	probably damaging	1.00
R2924:Unc13a	UTSW	8	71644952	missense	possibly damaging	0.88
R3177:Unc13a	UTSW	8	71629695	missense	probably benign	0.01
R4175:Unc13a	UTSW	8	71667724	intron	probably benign
R4279:Unc13a	UTSW	8	71666667	missense	probably damaging	0.98
R4629:Unc13a	UTSW	8	71653453	missense	possibly damaging	0.65
R4803:Unc13a	UTSW	8	71662850	splice site	probably null
R4877:Unc13a	UTSW	8	71658616	missense	possibly damaging	0.85
R4927:Unc13a	UTSW	8	71654845	missense	probably damaging	1.00
R4930:Unc13a	UTSW	8	71630504	splice site	probably null
R4994:Unc13a	UTSW	8	71643172	missense	probably benign	0.28
R5011:Unc13a	UTSW	8	71641477	nonsense	probably null
R5252:Unc13a	UTSW	8	71652564	missense	probably damaging	1.00
R5356:Unc13a	UTSW	8	71662514	missense	probably benign	0.02
R5458:Unc13a	UTSW	8	71664245	missense	probably damaging	1.00
R5514:Unc13a	UTSW	8	71643151	missense	probably damaging	1.00
R5784:Unc13a	UTSW	8	71655666	missense	possibly damaging	0.61
R5853:Unc13a	UTSW	8	71655129	splice site	probably null
R6183:Unc13a	UTSW	8	71644666	missense	probably damaging	1.00
R6277:Unc13a	UTSW	8	71666639	critical splice donor site	probably null
R6374:Unc13a	UTSW	8	71641453	missense	possibly damaging	0.70
R6392:Unc13a	UTSW	8	71637809	missense	possibly damaging	0.83
R6515:Unc13a	UTSW	8	71647940	missense	probably benign	0.44
R6576:Unc13a	UTSW	8	71653478	missense	probably benign	0.00
R6943:Unc13a	UTSW	8	71652377	missense	probably damaging	1.00
R7045:Unc13a	UTSW	8	71658763	missense	possibly damaging	0.95
R7062:Unc13a	UTSW	8	71663237	missense	probably benign	0.00
R7146:Unc13a	UTSW	8	71630553	missense	probably damaging	1.00
R7260:Unc13a	UTSW	8	71660585	missense	possibly damaging	0.71
R7443:Unc13a	UTSW	8	71630959	missense	probably damaging	0.98
R7545:Unc13a	UTSW	8	71641509	critical splice acceptor site	probably null
R7644:Unc13a	UTSW	8	71634538	missense	probably benign	0.13
R7780:Unc13a	UTSW	8	71658335	missense	probably benign	0.02
R7952:Unc13a	UTSW	8	71658487	missense	possibly damaging	0.71
R7989:Unc13a	UTSW	8	71652273	missense	probably damaging	1.00
R8169:Unc13a	UTSW	8	71656289	missense	probably damaging	1.00
R8503:Unc13a	UTSW	8	71645761	missense	possibly damaging	0.67
R8504:Unc13a	UTSW	8	71645761	missense	possibly damaging	0.67
R8675:Unc13a	UTSW	8	71645715	missense	probably benign	0.00
R8929:Unc13a	UTSW	8	71651191	missense	probably benign	0.01
R8945:Unc13a	UTSW	8	71647953	missense	probably damaging	0.99
R8979:Unc13a	UTSW	8	71660481	missense	probably benign	0.07
R9109:Unc13a	UTSW	8	71655691	missense	possibly damaging	0.65
R9136:Unc13a	UTSW	8	71652350	missense	possibly damaging	0.93
R9235:Unc13a	UTSW	8	71663268	missense	probably benign
R9298:Unc13a	UTSW	8	71655691	missense	possibly damaging	0.65
R9355:Unc13a	UTSW	8	71645731	missense	possibly damaging	0.67
R9483:Unc13a	UTSW	8	71650577	missense	probably benign	0.01
R9647:Unc13a	UTSW	8	71652238	missense	probably damaging	0.98
R9696:Unc13a	UTSW	8	71629553	missense	possibly damaging	0.91
Z1088:Unc13a	UTSW	8	71654803	critical splice donor site	probably null
Z1177:Unc13a	UTSW	8	71644872	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGAGCTTGACGAATTCCTTGGC -3'
(R):5'- TGGAAGGGGTTCTCTAGCCAAC -3'

Sequencing Primer
(F):5'- GACGAATTCCTTGGCCACCTC -3'
(R):5'- CTAGCCAACTTTCTAGGAGTACG -3'

Posted On

2015-01-23