Mutagenetix > Incidental Mutation

Incidental Mutation 'R3277:Zfp423'

258270

Institutional Source

Beutler Lab

Gene Symbol

Zfp423

Ensembl Gene

ENSMUSG00000045333

Gene Name

zinc finger protein 423

Synonyms

Zfp104, ataxia1, Ebfaz, Roaz

Accession Numbers

Essential gene?

Probably essential (E-score: 0.849) question?

Stock #

R3277 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

87661810-87959595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87782331 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 462 (Y462H)

Ref Sequence

ENSEMBL: ENSMUSP00000105282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052250] [ENSMUST00000109655] [ENSMUST00000165770] [ENSMUST00000174249] [ENSMUST00000174764]

AlphaFold

Q80TS5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052250
AA Change: Y441H

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000052379
Gene: ENSMUSG00000045333
AA Change: Y441H

Domain	Start	End	E-Value	Type
low complexity region	39	51	N/A	INTRINSIC
ZnF_C2H2	54	75	5.07e0	SMART
low complexity region	107	123	N/A	INTRINSIC
ZnF_C2H2	125	147	1.28e-3	SMART
ZnF_C2H2	153	175	1.64e-1	SMART
ZnF_C2H2	181	203	2.05e-2	SMART
ZnF_C2H2	209	231	3.21e-4	SMART
ZnF_C2H2	250	273	5.42e-2	SMART
ZnF_C2H2	282	305	1.76e-1	SMART
ZnF_C2H2	310	332	8.67e-1	SMART
low complexity region	350	364	N/A	INTRINSIC
ZnF_C2H2	396	420	1.16e-1	SMART
ZnF_C2H2	428	451	3.52e-1	SMART
ZnF_C2H2	467	490	7.9e-4	SMART
low complexity region	492	503	N/A	INTRINSIC
ZnF_C2H2	504	527	2.53e-2	SMART
ZnF_C2H2	550	575	3.99e0	SMART
low complexity region	591	602	N/A	INTRINSIC
ZnF_C2H2	619	641	3.16e-3	SMART
ZnF_C2H2	649	671	5.81e-2	SMART
ZnF_C2H2	679	702	4.87e-4	SMART
ZnF_C2H2	707	730	7.26e-3	SMART
ZnF_C2H2	737	760	4.79e-3	SMART
ZnF_C2H2	768	790	1.36e-2	SMART
ZnF_C2H2	794	817	4.72e-2	SMART
ZnF_C2H2	873	896	4.12e0	SMART
ZnF_C2H2	917	939	5.59e-4	SMART
ZnF_C2H2	946	968	6.42e-4	SMART
ZnF_C2H2	975	997	4.94e0	SMART
ZnF_C2H2	1007	1029	4.99e1	SMART
Pfam:zf-C2H2_6	1050	1068	1.6e-1	PFAM
ZnF_C2H2	1107	1130	1.12e-3	SMART
ZnF_C2H2	1155	1177	1.45e-2	SMART
ZnF_C2H2	1185	1207	5.72e-1	SMART
ZnF_C2H2	1216	1239	1.18e-2	SMART
ZnF_C2H2	1246	1269	4.05e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000109655
AA Change: Y462H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105282
Gene: ENSMUSG00000045333
AA Change: Y462H

Domain	Start	End	E-Value	Type
low complexity region	60	72	N/A	INTRINSIC
ZnF_C2H2	75	96	5.07e0	SMART
low complexity region	128	144	N/A	INTRINSIC
ZnF_C2H2	146	168	1.28e-3	SMART
ZnF_C2H2	174	196	1.64e-1	SMART
ZnF_C2H2	202	224	2.05e-2	SMART
ZnF_C2H2	230	252	3.21e-4	SMART
ZnF_C2H2	271	294	5.42e-2	SMART
ZnF_C2H2	303	326	1.76e-1	SMART
ZnF_C2H2	331	353	8.67e-1	SMART
low complexity region	371	385	N/A	INTRINSIC
ZnF_C2H2	417	441	1.16e-1	SMART
ZnF_C2H2	449	472	3.52e-1	SMART
ZnF_C2H2	488	511	7.9e-4	SMART
low complexity region	513	524	N/A	INTRINSIC
ZnF_C2H2	525	548	2.53e-2	SMART
ZnF_C2H2	571	596	3.99e0	SMART
low complexity region	612	623	N/A	INTRINSIC
ZnF_C2H2	640	662	3.16e-3	SMART
ZnF_C2H2	670	692	5.81e-2	SMART
ZnF_C2H2	700	723	4.87e-4	SMART
ZnF_C2H2	728	751	7.26e-3	SMART
ZnF_C2H2	758	781	4.79e-3	SMART
ZnF_C2H2	789	811	1.36e-2	SMART
ZnF_C2H2	815	838	4.72e-2	SMART
ZnF_C2H2	894	917	4.12e0	SMART
ZnF_C2H2	938	960	5.59e-4	SMART
ZnF_C2H2	967	989	6.42e-4	SMART
ZnF_C2H2	996	1018	4.94e0	SMART
ZnF_C2H2	1028	1050	4.99e1	SMART
ZnF_C2H2	1128	1151	1.12e-3	SMART
ZnF_C2H2	1176	1198	1.45e-2	SMART
ZnF_C2H2	1206	1228	5.72e-1	SMART
ZnF_C2H2	1237	1260	1.18e-2	SMART
ZnF_C2H2	1267	1290	4.05e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000165770
AA Change: Y337H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129724
Gene: ENSMUSG00000045333
AA Change: Y337H

Domain	Start	End	E-Value	Type
low complexity region	3	19	N/A	INTRINSIC
ZnF_C2H2	21	43	1.28e-3	SMART
ZnF_C2H2	49	71	1.64e-1	SMART
ZnF_C2H2	77	99	2.05e-2	SMART
ZnF_C2H2	105	127	3.21e-4	SMART
ZnF_C2H2	146	169	5.42e-2	SMART
ZnF_C2H2	178	201	1.76e-1	SMART
ZnF_C2H2	206	228	8.67e-1	SMART
low complexity region	246	260	N/A	INTRINSIC
ZnF_C2H2	292	316	1.16e-1	SMART
ZnF_C2H2	324	347	3.52e-1	SMART
ZnF_C2H2	363	386	7.9e-4	SMART
low complexity region	388	399	N/A	INTRINSIC
ZnF_C2H2	400	423	2.53e-2	SMART
ZnF_C2H2	446	471	3.99e0	SMART
low complexity region	487	498	N/A	INTRINSIC
ZnF_C2H2	515	537	3.16e-3	SMART
ZnF_C2H2	545	567	5.81e-2	SMART
ZnF_C2H2	575	598	4.87e-4	SMART
ZnF_C2H2	603	626	7.26e-3	SMART
ZnF_C2H2	633	656	4.79e-3	SMART
ZnF_C2H2	664	686	1.36e-2	SMART
ZnF_C2H2	690	713	4.72e-2	SMART
ZnF_C2H2	769	792	4.12e0	SMART
ZnF_C2H2	813	835	5.59e-4	SMART
ZnF_C2H2	842	864	6.42e-4	SMART
ZnF_C2H2	871	893	4.94e0	SMART
ZnF_C2H2	903	925	4.99e1	SMART
Pfam:zf-C2H2_6	946	964	2.5e-1	PFAM
ZnF_C2H2	1003	1026	1.12e-3	SMART
ZnF_C2H2	1051	1073	1.45e-2	SMART
ZnF_C2H2	1081	1103	5.72e-1	SMART
ZnF_C2H2	1112	1135	1.18e-2	SMART
ZnF_C2H2	1142	1165	4.05e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173092

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173725

Predicted Effect

probably benign
Transcript: ENSMUST00000174249

SMART Domains

Protein: ENSMUSP00000134103
Gene: ENSMUSG00000045333

Domain	Start	End	E-Value	Type
low complexity region	60	76	N/A	INTRINSIC
ZnF_C2H2	78	100	1.28e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174764

SMART Domains

Protein: ENSMUSP00000134575
Gene: ENSMUSG00000045333

Domain	Start	End	E-Value	Type
low complexity region	63	75	N/A	INTRINSIC
ZnF_C2H2	78	99	5.07e0	SMART
low complexity region	131	147	N/A	INTRINSIC
ZnF_C2H2	149	171	1.28e-3	SMART
ZnF_C2H2	177	199	1.64e-1	SMART
ZnF_C2H2	205	227	2.05e-2	SMART
Pfam:zf-C2H2_6	232	244	2.5e-1	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear protein that belongs to the family of Kruppel-like C2H2 zinc finger proteins. It functions as a DNA-binding transcription factor by using distinct zinc fingers in different signaling pathways. Thus, it is thought that this gene may have multiple roles in signal transduction during development. Mutations in this gene are associated with nephronophthisis-14 and Joubert syndrome-19. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mutations in this gene lead to postnatal lethality, abnormal gait, ataxia, reduced body size, loss of the corpus callosum, reduction of the hippocampus, olfactory bulb defects, and variable malformation of the cerebellum, including vermis agenesis, due to reduced proliferation of neural precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Zfp423

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01325:Zfp423	APN	8	87781611	splice site	probably null
IGL01359:Zfp423	APN	8	87780662	missense	probably damaging	1.00
IGL01780:Zfp423	APN	8	87781508	missense	probably damaging	1.00
IGL02250:Zfp423	APN	8	87783255	missense	probably damaging	1.00
IGL02301:Zfp423	APN	8	87781574	missense	probably damaging	1.00
IGL02320:Zfp423	APN	8	87781602	missense	probably damaging	1.00
IGL02804:Zfp423	APN	8	87782657	missense	probably benign	0.02
IGL03090:Zfp423	APN	8	87781443	missense	probably damaging	1.00
IGL03198:Zfp423	APN	8	87781676	missense	possibly damaging	0.73
IGL03383:Zfp423	APN	8	87859452	nonsense	probably null
swell	UTSW	8	87686559	splice site	probably null
Temptation	UTSW	8	87781753	missense	probably benign	0.25
trials	UTSW	8	87780713	missense	probably damaging	1.00
R0110:Zfp423	UTSW	8	87782259	missense	possibly damaging	0.60
R0142:Zfp423	UTSW	8	87780340	nonsense	probably null
R0256:Zfp423	UTSW	8	87773634	nonsense	probably null
R0538:Zfp423	UTSW	8	87782085	missense	probably damaging	0.99
R0542:Zfp423	UTSW	8	87780609	missense	probably damaging	1.00
R0614:Zfp423	UTSW	8	87782114	missense	probably damaging	1.00
R1179:Zfp423	UTSW	8	87688072	missense	probably damaging	0.97
R1417:Zfp423	UTSW	8	87773656	splice site	probably null
R1429:Zfp423	UTSW	8	87686442	missense	probably damaging	0.99
R1570:Zfp423	UTSW	8	87782558	missense	probably benign	0.37
R2013:Zfp423	UTSW	8	87782397	missense	probably benign	0.43
R2043:Zfp423	UTSW	8	87782618	missense	probably damaging	1.00
R2064:Zfp423	UTSW	8	87781358	missense	probably benign	0.04
R2108:Zfp423	UTSW	8	87781178	missense	possibly damaging	0.73
R2358:Zfp423	UTSW	8	87780551	missense	possibly damaging	0.56
R3177:Zfp423	UTSW	8	87782331	missense	probably damaging	1.00
R3738:Zfp423	UTSW	8	87781344	missense	probably damaging	1.00
R3739:Zfp423	UTSW	8	87781344	missense	probably damaging	1.00
R3773:Zfp423	UTSW	8	87780512	missense	probably benign	0.03
R4034:Zfp423	UTSW	8	87781344	missense	probably damaging	1.00
R4425:Zfp423	UTSW	8	87782973	missense	probably damaging	1.00
R4611:Zfp423	UTSW	8	87688081	missense	possibly damaging	0.90
R4700:Zfp423	UTSW	8	87781710	splice site	probably null
R4753:Zfp423	UTSW	8	87781446	missense	probably benign	0.00
R4818:Zfp423	UTSW	8	87904500	missense	probably benign	0.00
R5026:Zfp423	UTSW	8	87780674	missense	probably damaging	1.00
R5190:Zfp423	UTSW	8	87782463	missense	probably damaging	1.00
R5243:Zfp423	UTSW	8	87773647	missense	probably benign	0.03
R5284:Zfp423	UTSW	8	87781677	missense	possibly damaging	0.73
R5586:Zfp423	UTSW	8	87859340	missense	possibly damaging	0.93
R5601:Zfp423	UTSW	8	87782009	missense	probably damaging	1.00
R5671:Zfp423	UTSW	8	87782327	missense	probably damaging	0.99
R5717:Zfp423	UTSW	8	87686559	splice site	probably null
R5801:Zfp423	UTSW	8	87859362	missense	probably damaging	0.99
R5917:Zfp423	UTSW	8	87782232	nonsense	probably null
R5985:Zfp423	UTSW	8	87782146	missense	possibly damaging	0.83
R6111:Zfp423	UTSW	8	87782687	missense	probably damaging	0.99
R6306:Zfp423	UTSW	8	87782034	missense	possibly damaging	0.64
R6770:Zfp423	UTSW	8	87781817	missense	probably damaging	0.99
R6970:Zfp423	UTSW	8	87803779	missense	probably benign	0.00
R7029:Zfp423	UTSW	8	87688066	missense	probably damaging	0.99
R7060:Zfp423	UTSW	8	87782879	missense	probably damaging	1.00
R7074:Zfp423	UTSW	8	87782432	missense	probably benign	0.00
R7121:Zfp423	UTSW	8	87780861	missense	probably damaging	1.00
R7242:Zfp423	UTSW	8	87904527	missense	probably benign	0.07
R7359:Zfp423	UTSW	8	87782243	missense	possibly damaging	0.52
R7426:Zfp423	UTSW	8	87780713	missense	probably damaging	1.00
R7540:Zfp423	UTSW	8	87688067	missense	possibly damaging	0.95
R7640:Zfp423	UTSW	8	87781277	missense	probably damaging	1.00
R7767:Zfp423	UTSW	8	87780884	missense	probably damaging	1.00
R7938:Zfp423	UTSW	8	87895676	missense	unknown
R7986:Zfp423	UTSW	8	87780350	missense	probably benign	0.04
R8347:Zfp423	UTSW	8	87783156	missense	probably damaging	0.99
R8356:Zfp423	UTSW	8	87783282	missense	probably damaging	1.00
R8676:Zfp423	UTSW	8	87782710	missense	probably benign	0.04
R8710:Zfp423	UTSW	8	87780921	missense	possibly damaging	0.74
R8794:Zfp423	UTSW	8	87781229	missense	probably damaging	1.00
R8832:Zfp423	UTSW	8	87781199	missense	probably damaging	0.98
R9018:Zfp423	UTSW	8	87781753	missense	probably benign	0.25
R9182:Zfp423	UTSW	8	87782114	missense	probably damaging	0.99
R9309:Zfp423	UTSW	8	87783060	missense	probably damaging	0.99
R9312:Zfp423	UTSW	8	87781941	missense	probably damaging	1.00
R9453:Zfp423	UTSW	8	87781623	missense	probably damaging	1.00
R9469:Zfp423	UTSW	8	87782891	missense	probably damaging	0.99
R9480:Zfp423	UTSW	8	87904487	critical splice donor site	probably null
R9483:Zfp423	UTSW	8	87781097	missense	possibly damaging	0.90
R9510:Zfp423	UTSW	8	87783413	missense	possibly damaging	0.94
R9521:Zfp423	UTSW	8	87782405	missense	probably damaging	1.00
R9606:Zfp423	UTSW	8	87687967	missense	probably damaging	0.99
R9789:Zfp423	UTSW	8	87780249	missense	probably benign	0.03
Z1176:Zfp423	UTSW	8	87859420	missense	possibly damaging	0.49
Z1177:Zfp423	UTSW	8	87780925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGAAAGCATTATTCCCATCAGG -3'
(R):5'- ACTCCACCTTGAAGCCACTG -3'

Sequencing Primer
(F):5'- GGGGGTTGGCATTGGGG -3'
(R):5'- ACCTTGAAGCCACTGAGGGG -3'

Posted On

2015-01-23