Mutagenetix > Incidental Mutation

Incidental Mutation 'R3277:Sgk1'

258274

Institutional Source

Beutler Lab

Gene Symbol

Sgk1

Ensembl Gene

ENSMUSG00000019970

Gene Name

serum/glucocorticoid regulated kinase 1

Synonyms

Sgk, Sgk1

Accession Numbers

Ncbi RefSeq: NM_001161845.2, NM_001161847.2, NM_001161848.2, NM_001161849.2, NM_001161850.2, NM_011361.3; MGI:1340062

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3277 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21882184-21999903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 21996601 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 171 (R171W)

Ref Sequence

ENSEMBL: ENSMUSP00000128873 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020145] [ENSMUST00000092673] [ENSMUST00000100036] [ENSMUST00000120509] [ENSMUST00000124350] [ENSMUST00000142174] [ENSMUST00000150089] [ENSMUST00000164659]

AlphaFold

Q9WVC6

Predicted Effect

probably damaging
Transcript: ENSMUST00000020145
AA Change: R198W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020145
Gene: ENSMUSG00000019970
AA Change: R198W

Domain	Start	End	E-Value	Type
Blast:S_TKc	36	72	4e-10	BLAST
low complexity region	73	80	N/A	INTRINSIC
S_TKc	98	355	6.15e-106	SMART
S_TK_X	356	425	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000092673
AA Change: R212W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090343
Gene: ENSMUSG00000019970
AA Change: R212W

Domain	Start	End	E-Value	Type
low complexity region	7	20	N/A	INTRINSIC
Blast:S_TKc	50	86	5e-10	BLAST
low complexity region	87	94	N/A	INTRINSIC
S_TKc	112	369	6.15e-106	SMART
S_TK_X	370	439	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100036
AA Change: R184W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097614
Gene: ENSMUSG00000019970
AA Change: R184W

Domain	Start	End	E-Value	Type
Blast:S_TKc	22	58	5e-10	BLAST
low complexity region	59	66	N/A	INTRINSIC
S_TKc	84	341	6.15e-106	SMART
S_TK_X	342	411	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000120509
AA Change: R291W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114074
Gene: ENSMUSG00000019970
AA Change: R291W

Domain	Start	End	E-Value	Type
Blast:S_TKc	129	165	1e-9	BLAST
low complexity region	166	173	N/A	INTRINSIC
S_TKc	191	448	6.15e-106	SMART
S_TK_X	449	518	2.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000124350
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114691
Gene: ENSMUSG00000019970
AA Change: R171W

Domain	Start	End	E-Value	Type
Blast:S_TKc	9	45	2e-12	BLAST
low complexity region	46	53	N/A	INTRINSIC
Pfam:Pkinase	71	266	3.2e-62	PFAM
Pfam:Pkinase_Tyr	71	266	4.4e-34	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141218

Predicted Effect

probably benign
Transcript: ENSMUST00000142174

SMART Domains

Protein: ENSMUSP00000120882
Gene: ENSMUSG00000019970

Domain	Start	End	E-Value	Type
Blast:S_TKc	9	45	3e-14	BLAST
PDB:3HDN\|A	33	82	7e-18	PDB
SCOP:d1koba_	43	82	4e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000150089

SMART Domains

Protein: ENSMUSP00000115073
Gene: ENSMUSG00000019970

Domain	Start	End	E-Value	Type
Blast:S_TKc	22	58	4e-14	BLAST
PDB:3HDN\|A	46	89	3e-13	PDB

Predicted Effect

probably damaging
Transcript: ENSMUST00000164659
AA Change: R171W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128873
Gene: ENSMUSG00000019970
AA Change: R171W

Domain	Start	End	E-Value	Type
Blast:S_TKc	9	45	5e-10	BLAST
low complexity region	46	53	N/A	INTRINSIC
S_TKc	71	328	6.15e-106	SMART
S_TK_X	329	398	2.51e-19	SMART

Meta Mutation Damage Score

0.7105

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.6%

Validation Efficiency

MGI Phenotype

Strain: 3846797; 2445418
FUNCTION: This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. This enzyme is activated by protein phosphorylation and degraded via the ubiquitination and proteasome pathway. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene was identified on chromosome 12. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a disruption in this gene display an essentially normal phenotype. Sodium retention is compromised on a low salt diet. [provided by MGI curators]

Allele List at MGI

All alleles(143) : Targeted(6) Gene trapped(137)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921509C19Rik	T	C	2: 151,472,100	R553G	possibly damaging	Het
Adarb2	A	G	13: 8,752,627	N646S	probably damaging	Het
Adcy8	C	T	15: 64,699,159	G1242S	probably benign	Het
Ano9	T	A	7: 141,104,124	T543S	probably damaging	Het
Btnl10	A	G	11: 58,922,390	K282E	probably benign	Het
Btnl9	T	C	11: 49,169,676	D330G	probably damaging	Het
Ccdc178	G	T	18: 22,067,652	A416E	possibly damaging	Het
Cdx2	A	T	5: 147,303,192	S225T	probably benign	Het
Clca4b	T	C	3: 144,911,359	I843M	probably benign	Het
Cntn4	G	A	6: 106,437,964		probably null	Het
Cyp4f18	T	C	8: 71,993,200	D317G	possibly damaging	Het
Dennd4a	G	T	9: 64,888,993	R767L	probably damaging	Het
Dgkb	G	A	12: 38,084,217	V41M	probably damaging	Het
Duox1	T	C	2: 122,340,116	Y1206H	probably damaging	Het
Dync1i1	T	C	6: 5,972,211		probably null	Het
Fbxw2	T	C	2: 34,822,750	T100A	probably benign	Het
Fcgbp	C	A	7: 28,091,661	H782Q	probably damaging	Het
Flg2	A	T	3: 93,214,888	Q1455L	unknown	Het
Frrs1	T	C	3: 116,899,224	F49S	probably damaging	Het
Gli3	A	T	13: 15,725,982	Q1318L	probably benign	Het
Gm5592	A	G	7: 41,288,380	E362G	probably benign	Het
Gm7104	A	T	12: 88,285,728		noncoding transcript	Het
Gpatch2l	A	G	12: 86,244,315	T91A	possibly damaging	Het
Hacd4	T	C	4: 88,437,510	H46R	probably damaging	Het
Herc2	T	C	7: 56,153,428	V2175A	probably benign	Het
Hey1	T	C	3: 8,664,891	S169G	probably benign	Het
Hivep2	C	A	10: 14,128,969	T437K	probably benign	Het
Hlf	T	C	11: 90,345,835	K199E	probably damaging	Het
Hpgd	C	A	8: 56,298,413	A92E	probably damaging	Het
Hsp90aa1	T	A	12: 110,695,680	M1L	possibly damaging	Het
Hsp90aa1	C	A	12: 110,695,681		probably null	Het
Itgad	C	A	7: 128,190,981	H651N	possibly damaging	Het
Itgav	A	G	2: 83,776,542	D409G	probably damaging	Het
Kif2a	A	G	13: 106,976,756	I455T	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc3	G	T	2: 31,908,625	G448C	probably damaging	Het
Ltbp1	G	A	17: 75,276,480	G425D	possibly damaging	Het
Ltbp1	T	A	17: 75,359,278		probably null	Het
Mag	C	T	7: 30,901,648		probably null	Het
Mdh1b	G	A	1: 63,711,531	T426M	possibly damaging	Het
Nr1h4	G	A	10: 89,478,788	T282I	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr1231	C	T	2: 89,303,218	V125M	possibly damaging	Het
Olfr1412	A	G	1: 92,588,813	N161S	probably benign	Het
Olfr552	T	C	7: 102,604,576	V74A	possibly damaging	Het
Padi6	A	G	4: 140,735,389	L307P	probably damaging	Het
Parp9	T	C	16: 35,948,208	S20P	probably damaging	Het
Pdcd11	T	C	19: 47,113,264	F963L	probably damaging	Het
Pwp1	C	T	10: 85,882,079	L294F	probably benign	Het
Radil	A	G	5: 142,506,856	L339P	probably damaging	Het
Raver1	G	A	9: 21,079,277	P316S	possibly damaging	Het
Rell1	A	G	5: 63,926,987		probably null	Het
Rxrg	A	G	1: 167,635,700	D257G	possibly damaging	Het
Sema4c	C	T	1: 36,549,879	R722H	possibly damaging	Het
Spata7	A	G	12: 98,637,598	N75D	possibly damaging	Het
Ttc23l	A	G	15: 10,547,232	F99L	possibly damaging	Het
Unc13a	A	C	8: 71,629,695	C1642G	probably benign	Het
Usp36	C	T	11: 118,276,759		probably null	Het
Wrn	A	G	8: 33,317,554	M292T	probably damaging	Het
Zfp423	A	G	8: 87,782,331	Y462H	probably damaging	Het
Zscan5b	T	A	7: 6,231,346	Y124N	possibly damaging	Het
Zswim9	T	C	7: 13,277,270	T51A	possibly damaging	Het

Other mutations in Sgk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02318:Sgk1	APN	10	21995541	missense	probably damaging	1.00
IGL02670:Sgk1	APN	10	21928546	missense	probably benign
IGL03220:Sgk1	APN	10	21997391	missense	probably null	1.00
R0010:Sgk1	UTSW	10	21997438	critical splice donor site	probably null
R0010:Sgk1	UTSW	10	21997438	critical splice donor site	probably null
R0467:Sgk1	UTSW	10	21996358	splice site	probably benign
R0479:Sgk1	UTSW	10	21996310	missense	probably benign	0.00
R0650:Sgk1	UTSW	10	21882657	missense	probably damaging	0.98
R0652:Sgk1	UTSW	10	21882657	missense	probably damaging	0.98
R0688:Sgk1	UTSW	10	21998160	missense	probably benign
R0990:Sgk1	UTSW	10	21997086	missense	probably damaging	1.00
R1769:Sgk1	UTSW	10	21997108	splice site	probably benign
R2009:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R2218:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R2314:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R2909:Sgk1	UTSW	10	21994816	missense	probably benign
R2915:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3176:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3177:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3276:Sgk1	UTSW	10	21996601	missense	probably damaging	1.00
R3802:Sgk1	UTSW	10	21997412	missense	probably damaging	1.00
R5974:Sgk1	UTSW	10	21996249	missense	probably damaging	1.00
R6943:Sgk1	UTSW	10	21882694	missense	probably damaging	0.99
R7360:Sgk1	UTSW	10	21994073	missense	probably benign	0.01
R7425:Sgk1	UTSW	10	21994110	missense	probably damaging	0.97
R7665:Sgk1	UTSW	10	21996662	missense	probably damaging	1.00
R7973:Sgk1	UTSW	10	21994155	missense	probably benign	0.01
R8252:Sgk1	UTSW	10	21997399	missense	probably damaging	1.00
R8855:Sgk1	UTSW	10	21995827	missense	probably benign	0.12
R9199:Sgk1	UTSW	10	21882659	missense	probably damaging	0.99
R9492:Sgk1	UTSW	10	21998197	missense	probably damaging	0.97
R9670:Sgk1	UTSW	10	21992391	frame shift	probably null
R9683:Sgk1	UTSW	10	21992391	frame shift	probably null
R9723:Sgk1	UTSW	10	21996340	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCCAGACCGCTGACAAGC -3'
(R):5'- TTAGAGGTGACCAAAGTGCAC -3'

Sequencing Primer
(F):5'- CCTGGACTACATTAATGGTGGAG -3'
(R):5'- GGTGACCAAAGTGCACATAATATCTC -3'

Posted On

2015-01-23